ID: 934732793

View in Genome Browser
Species Human (GRCh38)
Location 2:96669937-96669959
Sequence CTCAATGCCCAGAGGTTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934732785_934732793 14 Left 934732785 2:96669900-96669922 CCATGGGGCAGGCAGGATCCCAG No data
Right 934732793 2:96669937-96669959 CTCAATGCCCAGAGGTTTCCCGG No data
934732791_934732793 -5 Left 934732791 2:96669919-96669941 CCAGGGTGCAGAAGAGGGCTCAA No data
Right 934732793 2:96669937-96669959 CTCAATGCCCAGAGGTTTCCCGG No data
934732790_934732793 -4 Left 934732790 2:96669918-96669940 CCCAGGGTGCAGAAGAGGGCTCA No data
Right 934732793 2:96669937-96669959 CTCAATGCCCAGAGGTTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934732793 Original CRISPR CTCAATGCCCAGAGGTTTCC CGG Intergenic
No off target data available for this crispr