ID: 934735510

View in Genome Browser
Species Human (GRCh38)
Location 2:96687914-96687936
Sequence ACACCGCTGTGTCACCCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 103}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934735510_934735513 -4 Left 934735510 2:96687914-96687936 CCGCCAGGGTGACACAGCGGTGT 0: 1
1: 0
2: 0
3: 17
4: 103
Right 934735513 2:96687933-96687955 GTGTACGCCGAGATGGTGAGTGG 0: 1
1: 0
2: 0
3: 2
4: 52
934735510_934735515 3 Left 934735510 2:96687914-96687936 CCGCCAGGGTGACACAGCGGTGT 0: 1
1: 0
2: 0
3: 17
4: 103
Right 934735515 2:96687940-96687962 CCGAGATGGTGAGTGGTGAGCGG 0: 1
1: 0
2: 1
3: 21
4: 258
934735510_934735517 18 Left 934735510 2:96687914-96687936 CCGCCAGGGTGACACAGCGGTGT 0: 1
1: 0
2: 0
3: 17
4: 103
Right 934735517 2:96687955-96687977 GTGAGCGGCAGCCCAAGGCCAGG No data
934735510_934735516 13 Left 934735510 2:96687914-96687936 CCGCCAGGGTGACACAGCGGTGT 0: 1
1: 0
2: 0
3: 17
4: 103
Right 934735516 2:96687950-96687972 GAGTGGTGAGCGGCAGCCCAAGG 0: 1
1: 0
2: 1
3: 18
4: 170
934735510_934735522 30 Left 934735510 2:96687914-96687936 CCGCCAGGGTGACACAGCGGTGT 0: 1
1: 0
2: 0
3: 17
4: 103
Right 934735522 2:96687967-96687989 CCAAGGCCAGGGCAGGCACGCGG No data
934735510_934735518 19 Left 934735510 2:96687914-96687936 CCGCCAGGGTGACACAGCGGTGT 0: 1
1: 0
2: 0
3: 17
4: 103
Right 934735518 2:96687956-96687978 TGAGCGGCAGCCCAAGGCCAGGG No data
934735510_934735519 23 Left 934735510 2:96687914-96687936 CCGCCAGGGTGACACAGCGGTGT 0: 1
1: 0
2: 0
3: 17
4: 103
Right 934735519 2:96687960-96687982 CGGCAGCCCAAGGCCAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934735510 Original CRISPR ACACCGCTGTGTCACCCTGG CGG (reversed) Intergenic