ID: 934735615

View in Genome Browser
Species Human (GRCh38)
Location 2:96688397-96688419
Sequence GTGAAGGCCTAGAATGGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934735598_934735615 14 Left 934735598 2:96688360-96688382 CCCGGGACCCCTGCAGGCCCCAG No data
Right 934735615 2:96688397-96688419 GTGAAGGCCTAGAATGGTAGAGG No data
934735609_934735615 -4 Left 934735609 2:96688378-96688400 CCCAGTGGGGTCCCAGGAGGTGA No data
Right 934735615 2:96688397-96688419 GTGAAGGCCTAGAATGGTAGAGG No data
934735605_934735615 5 Left 934735605 2:96688369-96688391 CCTGCAGGCCCCAGTGGGGTCCC No data
Right 934735615 2:96688397-96688419 GTGAAGGCCTAGAATGGTAGAGG No data
934735603_934735615 7 Left 934735603 2:96688367-96688389 CCCCTGCAGGCCCCAGTGGGGTC No data
Right 934735615 2:96688397-96688419 GTGAAGGCCTAGAATGGTAGAGG No data
934735599_934735615 13 Left 934735599 2:96688361-96688383 CCGGGACCCCTGCAGGCCCCAGT No data
Right 934735615 2:96688397-96688419 GTGAAGGCCTAGAATGGTAGAGG No data
934735608_934735615 -3 Left 934735608 2:96688377-96688399 CCCCAGTGGGGTCCCAGGAGGTG No data
Right 934735615 2:96688397-96688419 GTGAAGGCCTAGAATGGTAGAGG No data
934735596_934735615 26 Left 934735596 2:96688348-96688370 CCAACAGGGCAGCCCGGGACCCC No data
Right 934735615 2:96688397-96688419 GTGAAGGCCTAGAATGGTAGAGG No data
934735610_934735615 -5 Left 934735610 2:96688379-96688401 CCAGTGGGGTCCCAGGAGGTGAA No data
Right 934735615 2:96688397-96688419 GTGAAGGCCTAGAATGGTAGAGG No data
934735604_934735615 6 Left 934735604 2:96688368-96688390 CCCTGCAGGCCCCAGTGGGGTCC No data
Right 934735615 2:96688397-96688419 GTGAAGGCCTAGAATGGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934735615 Original CRISPR GTGAAGGCCTAGAATGGTAG AGG Intergenic
No off target data available for this crispr