ID: 934740034

View in Genome Browser
Species Human (GRCh38)
Location 2:96713622-96713644
Sequence GGAGCTGTTTCCTGAGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 232}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934740034 Original CRISPR GGAGCTGTTTCCTGAGATCC TGG (reversed) Intronic
900159132 1:1215276-1215298 GCAGCTGTTTCCTGTGCTCCTGG - Intergenic
900553351 1:3267843-3267865 GGACCTGTGTCCTGTGAACCAGG - Intronic
900626778 1:3611938-3611960 AGGGCTGTCTCCTGAGATCGAGG - Intergenic
901230508 1:7639427-7639449 GGAGGAGTTTCCAGAGATTCTGG + Intronic
901259580 1:7861695-7861717 GGGGCTGTTTCCTGAGGGACGGG - Intergenic
902776295 1:18676878-18676900 GGGGCTGTTCTTTGAGATCCAGG + Intronic
903071935 1:20731063-20731085 GGAGCTGTTTCCTCAGGCCATGG + Intronic
903190027 1:21651205-21651227 GGAGGAGGTTCCTGAGAGCCAGG + Intronic
904289807 1:29477707-29477729 GCTGCTGTTTCATGAGAGCCTGG - Intergenic
904881184 1:33698399-33698421 GGGGCTTTTGCCTGAGTTCCAGG - Intronic
906255478 1:44345907-44345929 GGAGCAGTAGCCTGAGACCCTGG - Intronic
908936790 1:69385399-69385421 GGAGCTGCTTCTTTAGTTCCTGG - Intergenic
911787273 1:101966726-101966748 GGAGGTCTTTACTGAGATCCTGG + Intronic
912432955 1:109639159-109639181 GCAGCTCTTTCCTCAGAGCCTGG + Intergenic
914686545 1:149984943-149984965 GGAGCTATTTCCTGGGGTGCAGG - Intronic
915329961 1:155105055-155105077 CTAACTGTTTCCTGAGAGCCAGG - Intergenic
915752907 1:158228587-158228609 GGAGATGCTTCCTGAGAGCCAGG - Intergenic
917755422 1:178093878-178093900 GGAGCTGTGGCCTGAGAGTCAGG + Intergenic
918573376 1:186025444-186025466 GGTGCTGTTTCAGGAGATCTGGG - Intronic
920254989 1:204648684-204648706 GCAGCTGTGTGCTGAGAACCAGG + Intronic
923034087 1:230272027-230272049 GGAGCTGTTTGTTGGGAACCGGG + Intronic
923084824 1:230695228-230695250 GCAGCTGTTTCCTGTGACCAAGG + Intergenic
924099833 1:240591770-240591792 GGAGCTGTTTCAAAAGCTCCTGG - Intronic
1063445163 10:6108886-6108908 GGCGCTGCATTCTGAGATCCAGG - Intronic
1067051951 10:43026720-43026742 GGACCTGGATCCTGAGGTCCAGG - Intergenic
1067303901 10:45040506-45040528 AGTGGTGTTTCCTGAGATTCTGG - Intergenic
1069700926 10:70425216-70425238 GCAGCTGATTCCAGAGATCATGG + Exonic
1069717378 10:70529807-70529829 GGAGCTCTGTCCTGGGCTCCAGG - Intronic
1069997514 10:72351812-72351834 GGAGCGCTCTCCTGAGTTCCAGG + Intronic
1070142244 10:73746977-73746999 GGAGGTGTTTGCTGATAGCCTGG - Exonic
1070764569 10:79048971-79048993 GGGGCGGTTTCCTGGGATGCGGG - Intergenic
1071124004 10:82313550-82313572 GCAGCTGTTTCCTGGTGTCCTGG - Intronic
1072229969 10:93406451-93406473 GGAGATGTTTGCTGGGCTCCTGG + Intronic
1072616266 10:97050582-97050604 GGATGTGTTTGCTGATATCCTGG + Intronic
1073268132 10:102240796-102240818 GGAGCTGTGTTGTGAGAGCCCGG - Intronic
1075382753 10:122032293-122032315 GGAGGTGTTCCCAGTGATCCAGG - Intronic
1075469292 10:122676038-122676060 GGAGCAGTTTTCTGACACCCAGG - Intergenic
1075469310 10:122676140-122676162 GGAGCAGTTTCTTGCGATGCAGG + Intergenic
1076729545 10:132431512-132431534 GGAGCTCTTGTCTGAGTTCCAGG + Intergenic
1077392002 11:2304532-2304554 GGAGCTGTTTCCAAAGTCCCTGG + Intronic
1077574435 11:3370853-3370875 GGAGATGGTTTCTGAGAGCCTGG - Intronic
1078668606 11:13345954-13345976 GGAGGGGTTTCCTGGGATGCAGG + Intronic
1081249395 11:40811418-40811440 ACAGCTGTTTCCTAAGAGCCTGG + Intronic
1087138784 11:94745498-94745520 GGAGCTCTGTGCTGAGAACCAGG + Intronic
1088928110 11:114322602-114322624 TGTACTGTTCCCTGAGATCCAGG - Intergenic
1089327080 11:117664708-117664730 GGAACTGTTTCCTGATGGCCTGG + Intronic
1089455455 11:118623031-118623053 GGAGCCTGTTCCTGGGATCCTGG - Intronic
1089589444 11:119531178-119531200 GAAGCTGCTCCCTGTGATCCTGG - Intergenic
1092155625 12:6279811-6279833 GGAGCTGGGTCCTGAGATGGTGG + Intergenic
1096077328 12:48814037-48814059 GGAACAGTCTCCCGAGATCCCGG + Intronic
1096243747 12:49973248-49973270 GGCGCTGTTTGCAGAGTTCCTGG + Exonic
1097973241 12:65657653-65657675 TGGGCTTTATCCTGAGATCCAGG + Intergenic
1101611489 12:106296552-106296574 GTAGCTTTTACCTGAGTTCCTGG - Intronic
1101921841 12:108939310-108939332 GGGGCTGTTTTCAGAGTTCCAGG + Intronic
1103418856 12:120763647-120763669 GCTGCTGTGTCCTGAGAGCCTGG - Exonic
1103558514 12:121779914-121779936 GGGGCTGAATCCTGAGACCCGGG + Exonic
1104083289 12:125451844-125451866 TGAGTTTTTTCCTGATATCCTGG - Intronic
1104351463 12:128047747-128047769 AGAGCTTTTTCCTGAGCTTCTGG + Intergenic
1105017706 12:132796142-132796164 TGAGCTGTTTCATCAGGTCCAGG + Exonic
1105534892 13:21256780-21256802 GCATCTGTTTACTGAGAGCCTGG - Intergenic
1106173318 13:27307798-27307820 GCGGCTGTTGCCTGAGACCCAGG + Intergenic
1108970384 13:56368155-56368177 GGACCACTTTCCTGAGATACAGG + Intergenic
1109375442 13:61486330-61486352 AGATGTGTTTCCTGAGATGCAGG + Intergenic
1113190645 13:107742067-107742089 CGTGCTGTTTCCTGAGAACATGG - Intronic
1113879097 13:113612942-113612964 GGAGCTGCTGCCGGCGATCCAGG - Intronic
1114210707 14:20611888-20611910 GGATTTGTTTCCTGAGATATGGG + Intergenic
1115530115 14:34319239-34319261 GGTGCTGTTTGCTGAGGTTCTGG + Intronic
1115649227 14:35390997-35391019 GGATCTGGTTCCTCAGGTCCTGG + Intergenic
1116774945 14:49168163-49168185 GGAGCTGGTTCCAGAGGACCTGG + Intergenic
1117762768 14:59049465-59049487 GGAGCTGTGTCATGTCATCCTGG + Intergenic
1118887261 14:69878051-69878073 GAAGCTGTTTCATGGAATCCAGG + Intronic
1119770187 14:77215746-77215768 GGAGATGTTTACTGAGAGTCAGG - Intronic
1120252888 14:82080768-82080790 GGACCTGGCTCCTGAGATGCAGG - Intergenic
1123051065 14:105542837-105542859 GGAGCTGTTGCAAGAGATACAGG + Intergenic
1123625409 15:22223628-22223650 GTAGCTGTCTCCTGGGCTCCTGG - Intergenic
1123625457 15:22223965-22223987 GTAGCTGTCTCCTGGGCTCCTGG - Intergenic
1124442585 15:29697989-29698011 GGAGCTGTTGCCCAAGATGCAGG - Intergenic
1125922494 15:43533568-43533590 GAAGCTTTTTCCAAAGATCCAGG - Exonic
1126695064 15:51318693-51318715 AGGGCTGTTTCCTGGGATCAAGG + Intronic
1126798773 15:52281773-52281795 GGAGACATTTCCTGAGATCCTGG - Intronic
1128309304 15:66620645-66620667 GGAGCAGATCCCTGAGAGCCTGG + Intronic
1129335624 15:74850609-74850631 GGAGCTGTTGCCCGAGAACCAGG + Exonic
1130696201 15:86134326-86134348 TGAGCTGTGTCCTGAGCTCTTGG + Intergenic
1131533632 15:93215675-93215697 GTAGCTGTTTCCTCAAATCACGG + Intergenic
1132262154 15:100435076-100435098 AGAGCTGCTTCCTGAGAGCACGG - Intronic
1136236142 16:28914671-28914693 GGAGCTGATTCAGGAGATCCAGG - Exonic
1136270885 16:29147591-29147613 AGATCTGTTTCCTGGGACCCAGG + Intergenic
1137545605 16:49400913-49400935 GCAGCTGTTTCCTTGGATTCTGG - Intergenic
1139563520 16:67758527-67758549 GGATCTGTATCCCGAGACCCTGG - Intronic
1139945125 16:70635590-70635612 GGAGCTGTTTCCAGTGTTCAAGG + Intronic
1141272802 16:82556256-82556278 GGAGCAGTGTCCTGAGATTGTGG + Intergenic
1142074465 16:88109385-88109407 AGATCTGTTTCCTGGGACCCAGG + Intronic
1142965628 17:3579372-3579394 GGACCTGTCTCCTGGGATCTCGG - Intronic
1143340597 17:6207939-6207961 GGAGCCGTCCCCTGAGCTCCGGG + Intergenic
1146476198 17:33164536-33164558 ACAGCTGTTTCCAGAGAGCCTGG - Intronic
1147253006 17:39164982-39165004 GGAGCTCTTCCCTGGGTTCCCGG - Intronic
1147367529 17:39969000-39969022 TGACCTCTTTCCTGAGCTCCAGG - Intronic
1147459534 17:40559411-40559433 GGAGCATTTTCCTGGCATCCAGG + Intronic
1147548491 17:41421476-41421498 AGAGCAGTTGTCTGAGATCCGGG - Exonic
1147550456 17:41438202-41438224 GGAGCAGCTGTCTGAGATCCGGG - Exonic
1148212139 17:45815036-45815058 AGTGCTGTTTCCTGAGAGACTGG + Intronic
1148676048 17:49445665-49445687 GGGGCTGTGTCCTGCCATCCAGG - Intronic
1149350413 17:55781086-55781108 TGAGCTGGTTCCTGATCTCCTGG - Intronic
1149486289 17:57045647-57045669 AGAGCTGTTTTCTGTGCTCCTGG - Intergenic
1151630801 17:75309538-75309560 AGATCTGTCTCCTGAGCTCCAGG + Intergenic
1151955780 17:77379515-77379537 GGTGCTGTTCCCTGATAGCCTGG + Intronic
1153721046 18:7903426-7903448 GTAGCTGTTTCCTGGGAGGCAGG + Intronic
1156697620 18:39786043-39786065 TGAGCTGTATCCTCAGCTCCTGG + Intergenic
1157022271 18:43798990-43799012 GGAGCTGCCTTCTGAGATGCTGG - Intergenic
1158052503 18:53240477-53240499 GGAGCTGTCCCCTGTTATCCAGG + Intronic
1159117035 18:64126532-64126554 GGAGCTGTTCACTGAGATATAGG + Intergenic
1159565471 18:70043007-70043029 GGTGCAGTTTCCTGTCATCCTGG - Intronic
1160363858 18:78307844-78307866 GGAGCTGTTTCCAGATCTCTAGG - Intergenic
1160843890 19:1158278-1158300 GGAGCTGTGTCCTCGGAGCCCGG + Intronic
1161312839 19:3604339-3604361 GGCGCTGTTTCCAGAGGCCCGGG + Intronic
1162068157 19:8138071-8138093 GGAGCTCTCTCCCCAGATCCAGG + Intronic
1162585051 19:11553337-11553359 GGGACTGTTTCCTGACATCCTGG - Exonic
1164668948 19:30062346-30062368 GGAGCTGTGTCCTGGGGGCCTGG + Intergenic
1165795596 19:38517384-38517406 GGAGATGTGTCCCGACATCCCGG + Exonic
1165983935 19:39751130-39751152 GGAGGTGGTGCCTGAGATTCAGG - Intergenic
1167661248 19:50797214-50797236 AGAGCTGTCACCTGAGATTCCGG + Intergenic
1168100525 19:54138618-54138640 GCAGCTGGAACCTGAGATCCAGG - Intronic
926892897 2:17653266-17653288 AGAGTTGCTTCCTGAGGTCCAGG + Intronic
927952799 2:27184684-27184706 CCAGCTGCTTCCTGAGACCCTGG - Intergenic
929497977 2:42463360-42463382 GTTACTGTTTCCTGATATCCAGG + Intronic
929990151 2:46780202-46780224 GGAGCTGATTCCTGGAATCACGG - Intergenic
930466310 2:51754771-51754793 TGAGCTACTTCCTTAGATCCTGG + Intergenic
932432473 2:71684293-71684315 GTTGCTGTGACCTGAGATCCGGG + Intronic
934740034 2:96713622-96713644 GGAGCTGTTTCCTGAGATCCTGG - Intronic
934753764 2:96810987-96811009 GGAGCTGGGTCCCGAGAGCCTGG + Exonic
939070717 2:137538178-137538200 AGAGCTGATTCCTAAGATCAAGG - Intronic
940318597 2:152350235-152350257 GGAGCAGTTTCCAGGGACCCTGG + Intronic
940661095 2:156546246-156546268 AAAGCTGTTTCCTTAGAGCCAGG - Intronic
941984383 2:171495921-171495943 AGACCTCTTTCCTGAGATACAGG - Intergenic
942540614 2:177011686-177011708 GCAGCTGTTTTCTGAGTTGCTGG + Intergenic
943916705 2:193644193-193644215 GGGCCTGTTACCTGAGATACAGG + Intergenic
945440053 2:209867600-209867622 GTGGCTCCTTCCTGAGATCCTGG + Intronic
945980737 2:216308435-216308457 GGAGCTCTATCCTGAACTCCAGG + Intronic
947059298 2:226144636-226144658 GGAGCTGTTTCCAGTGTGCCAGG - Intergenic
948538223 2:238663886-238663908 AGAGCAGGTCCCTGAGATCCCGG - Intergenic
1171278882 20:23880175-23880197 GGAGCTGTTTCAGAAGCTCCGGG + Intergenic
1171348387 20:24484061-24484083 AGTGGTGTTTACTGAGATCCAGG + Intronic
1172361686 20:34317125-34317147 GGAGTTGTGGTCTGAGATCCTGG + Intergenic
1172753906 20:37270122-37270144 TGGGCTTTCTCCTGAGATCCTGG - Intergenic
1175273127 20:57748839-57748861 GGAGCTGTCTGCTGCCATCCTGG - Intergenic
1175458957 20:59136487-59136509 CCAGCTCTGTCCTGAGATCCTGG + Intergenic
1175976796 20:62714699-62714721 GGAGCTGTTTCTTGTGGTCTGGG - Intronic
1177874519 21:26615043-26615065 AAAGCTGTTTCCTGTGATACAGG + Intergenic
1178315090 21:31560369-31560391 GGAGCCCTTTACTGAGGTCCAGG - Intergenic
1179386820 21:40951177-40951199 GAGGTTGTTTCCTGAGAACCTGG - Intergenic
1180143431 21:45906712-45906734 GACACTGTTTCCTGAGCTCCCGG - Intronic
1180830627 22:18904189-18904211 GGATCTGTTTCCTCAGTCCCTGG - Intergenic
1181069051 22:20321098-20321120 GGATCTGTTTCCTCAGTCCCTGG + Intergenic
1181651759 22:24262810-24262832 GGAGCTGTGTCCTGCCATGCTGG - Intergenic
1183256578 22:36766146-36766168 GGAGCTGTTTTCGGAAATGCTGG - Exonic
1183381536 22:37492713-37492735 GGTGCTGTTGCCTGAGTGCCTGG - Exonic
1184644140 22:45886950-45886972 GGAAATGTTTGCTGAGAACCGGG + Intergenic
1185214479 22:49590598-49590620 GGGGCTGCTTCCTGAGAGCGCGG - Intronic
1203280717 22_KI270734v1_random:129460-129482 GGATCTGTTTCCTCAGTCCCTGG - Intergenic
950928491 3:16766507-16766529 GGAACTTTTTCCTGATATCAGGG - Intergenic
951680936 3:25294080-25294102 GGAGCTCTTTCCTGGGAAACAGG - Intronic
953599406 3:44348342-44348364 GGAGCTGTTCCCAGAGCCCCTGG - Intronic
953622893 3:44548146-44548168 GGAGCTTTCTCCTGACATCTGGG + Intergenic
955870809 3:63436616-63436638 GGAATTATTGCCTGAGATCCAGG + Intronic
956787288 3:72653184-72653206 GGAGCTGTTGGCTGAGATGGTGG + Intergenic
956787388 3:72653852-72653874 GGAGCTGTTGGCTGAGATGGTGG - Intergenic
956854271 3:73260601-73260623 GGAGCTGTTTTCTGTGATCATGG + Intergenic
957036409 3:75297361-75297383 TGAGCAGTTTCCTGAGACACAGG - Intergenic
960357860 3:116675782-116675804 TCAGATGTTTCCTGAGCTCCAGG + Intronic
960981645 3:123233762-123233784 GATGCTTTTTCCTAAGATCCAGG + Intronic
961455132 3:127020296-127020318 GGTGCTCTTTCCTGGGATCGAGG + Exonic
961565799 3:127762561-127762583 GGAGCTGGGGCCTGAGATCCGGG + Intronic
962544757 3:136421692-136421714 GGAGATGTTTGCTGATATCTTGG + Intronic
963538400 3:146556677-146556699 GGAGCTCTGTGCTGGGATCCAGG + Intergenic
965162209 3:165148828-165148850 AGAGGTGATTCCTGAGATGCTGG - Intergenic
968184342 3:196621627-196621649 GGAGCTGCTTCCCTAGATCAGGG + Intergenic
969466000 4:7356838-7356860 GGAGCCCTCTCCAGAGATCCAGG - Intronic
970644095 4:18099346-18099368 GTTGCTGTTTCCTGAGATGGAGG + Intergenic
970756132 4:19429006-19429028 TGAGCTGTTGTCTGACATCCAGG + Intergenic
972850189 4:43039468-43039490 GGTGCTGTTTCCTGGAATACCGG + Intergenic
977733019 4:100378360-100378382 GGATATTTCTCCTGAGATCCAGG + Intergenic
979286527 4:118931677-118931699 GGAGCTGGTTTCTGAGAATCTGG - Intronic
979805471 4:124965128-124965150 GGAGCTTTTTACTGACATCAGGG - Intergenic
981817669 4:148849645-148849667 GCAGCTGGTCCCTGAGCTCCAGG + Intergenic
982063167 4:151624913-151624935 AGAGCTGCTTGCTGAGAACCAGG + Intronic
983045102 4:162977038-162977060 GGAGCTTCTTCCTAAAATCCTGG + Intergenic
985207311 4:187552707-187552729 GGAACTGTTTCGTGAGACACAGG - Intergenic
985419530 4:189770097-189770119 GGAGCTTTTAGCTGAAATCCAGG + Intergenic
985836921 5:2278326-2278348 GGGGCTGTGTCCTGAGAGCTGGG - Intergenic
986293119 5:6416274-6416296 CCAGTGGTTTCCTGAGATCCTGG + Intergenic
991492062 5:67193423-67193445 GGAACTTATTCCTGAGATTCTGG - Intronic
993967697 5:94377772-94377794 GGATCTGTTTTCTGAGGTCTTGG + Intronic
996388832 5:122938115-122938137 GGAGCTGGTTCCTGAGTATCCGG - Intronic
998161407 5:139814743-139814765 GGAGCCCTTTCCTGAGCTCTGGG - Intronic
999877965 5:155829279-155829301 GGAACTGTTTCCTGGGCTCTGGG - Intergenic
1001042674 5:168348215-168348237 AGAGCTGGTTCCTGAGCTCAGGG + Intronic
1001763875 5:174229622-174229644 GGGGCTGTTTCCTAGCATCCCGG + Intronic
1002584357 5:180232703-180232725 GAAGATGTTTCTTGAGATACTGG - Intergenic
1003832830 6:10033369-10033391 GGAGCTGTTGCAAGAGTTCCTGG + Intronic
1005072461 6:21874466-21874488 GGGGCTGTTTCCAGATATCAGGG + Intergenic
1005931929 6:30490648-30490670 GGAGCTGTCACCTGAGGTACAGG + Intronic
1006801839 6:36764799-36764821 GGAGCTGTTTGCAGAGAGCCAGG - Intronic
1007751128 6:44072708-44072730 GGAGGTGTCTCCTGACTTCCAGG - Intergenic
1014852181 6:126354904-126354926 TGAGGGGTTTCCTGAGATGCAGG - Intergenic
1017915154 6:158825886-158825908 GGAGCTCTTTGCTGAGAACAGGG - Intergenic
1018089299 6:160331849-160331871 GGAGCTGGTACCTGATACCCGGG - Intergenic
1020603296 7:10303632-10303654 GGAGCACTTTCCTGAAATACAGG - Intergenic
1021621700 7:22555775-22555797 GGAGCTGTGTCCTGGGATGCTGG - Intronic
1023858466 7:44201218-44201240 TCAGCTTTTTCCAGAGATCCAGG + Exonic
1026077483 7:67185568-67185590 GAAACTGTTTGCTGAGATACAGG + Intronic
1026699387 7:72626583-72626605 GAAACTGTTTGCTGAGATACAGG - Intronic
1026912798 7:74101312-74101334 GCAGCTGGTCCCTGAAATCCAGG + Intronic
1028014578 7:85690797-85690819 GGAGCTATTTCCTTAGTTACAGG - Intergenic
1028874309 7:95803246-95803268 GGAGATGTTCTCTGAGATCTTGG - Intronic
1031624295 7:123974544-123974566 GAAGCTGTTTCCTCAATTCCAGG - Intergenic
1035140554 7:156755775-156755797 AGAGCTTTTTCCTTCGATCCAGG - Intronic
1035576854 8:713720-713742 GGACCTGCCTGCTGAGATCCTGG + Intronic
1035756937 8:2041750-2041772 GGGGCTGTTTTCTGAGATTCAGG + Intergenic
1038686045 8:29719311-29719333 TGAGCTGAGTCCTGGGATCCTGG + Intergenic
1039399656 8:37258661-37258683 GAAGTTGCTTCCTGTGATCCTGG - Intergenic
1039510196 8:38085750-38085772 GGCCCTGTTTCCTGAATTCCTGG + Intergenic
1041095666 8:54347099-54347121 GGAGCTCATGCCTGAAATCCCGG - Intergenic
1042160220 8:65885848-65885870 CTAGCTGTTTCCTGATTTCCAGG - Intergenic
1042303346 8:67309825-67309847 GTAGGTGTTTTCTGGGATCCAGG - Intronic
1043007977 8:74844389-74844411 GGGGCTTTTTCCTGAGATGGAGG - Intronic
1046240155 8:111479057-111479079 GTAGCTGTGTCCTGAGAACATGG - Intergenic
1046642465 8:116747665-116747687 GAAGCTCTTCTCTGAGATCCTGG - Intronic
1047034945 8:120927463-120927485 AGAAGTGTTTCCTGGGATCCAGG + Intergenic
1049011131 8:139888199-139888221 GGAGCTGTTTACTCAGGGCCAGG - Intronic
1050299424 9:4242172-4242194 GGAGCTGTTTCATGGGGTCCAGG - Intronic
1051722481 9:20052688-20052710 ACTGCTGTTTCCTGGGATCCTGG + Intergenic
1052822074 9:33145478-33145500 GGTGCTGTTTCCTTAGATTTAGG - Intronic
1053418968 9:37964901-37964923 TGAGCTCCTTCCTGAGTTCCGGG + Intronic
1055459647 9:76506695-76506717 GTGGCTGTTTACTGAGATCTGGG - Exonic
1057200583 9:93137683-93137705 GGAGCTGTTACCTGGCATCAGGG + Intergenic
1057436446 9:95045057-95045079 GGTGCTGTTTCCTGACACCCTGG + Intronic
1058428869 9:104900385-104900407 GTTCCTGTCTCCTGAGATCCTGG - Intronic
1059447134 9:114345452-114345474 GGTCCTGTTTCCTGAGACACAGG + Intronic
1060423095 9:123483415-123483437 GGATTTGTCTCCTGAGTTCCTGG - Intronic
1062053290 9:134458194-134458216 GGTGCTGTGCCCTGAGACCCAGG + Intergenic
1062219053 9:135404542-135404564 GGAGCTGGCTCCTGTGATCACGG + Intergenic
1187319464 X:18226889-18226911 GGAGCTGTGTCCGGGGCTCCAGG - Intergenic
1189537940 X:41955835-41955857 GCAGCTATTTCCTGAGATAAGGG - Intergenic
1193012810 X:76696792-76696814 GGAATTGTTTCCTGGGATCTGGG - Intergenic
1194973655 X:100371769-100371791 GGAGCTGTTTTCAGGGTTCCAGG - Intronic
1198186605 X:134259517-134259539 GGAGTGCTTTCCTGAGATACCGG - Intergenic
1201076540 Y:10194040-10194062 GGCCCTGTGTCCTGAGCTCCTGG - Intergenic