ID: 934741064

View in Genome Browser
Species Human (GRCh38)
Location 2:96722906-96722928
Sequence GCTGCTTGGAAGTCTGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116755
Summary {0: 1, 1: 12, 2: 485, 3: 10744, 4: 105513}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934741059_934741064 8 Left 934741059 2:96722875-96722897 CCAGGCGTGGTGGCAGGCGCCTG 0: 3899
1: 24362
2: 59781
3: 92583
4: 157353
Right 934741064 2:96722906-96722928 GCTGCTTGGAAGTCTGAAGCAGG 0: 1
1: 12
2: 485
3: 10744
4: 105513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934741064 Original CRISPR GCTGCTTGGAAGTCTGAAGC AGG Intronic
Too many off-targets to display for this crispr