ID: 934745428

View in Genome Browser
Species Human (GRCh38)
Location 2:96756486-96756508
Sequence GTGTGGATGATGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934745428_934745439 29 Left 934745428 2:96756486-96756508 CCTTCTTCCCTCATCATCCACAC No data
Right 934745439 2:96756538-96756560 GAAAATGAACGAGAAGACTGTGG No data
934745428_934745435 3 Left 934745428 2:96756486-96756508 CCTTCTTCCCTCATCATCCACAC No data
Right 934745435 2:96756512-96756534 GTGTTCTCCCTCTGGAAGAAAGG No data
934745428_934745433 -5 Left 934745428 2:96756486-96756508 CCTTCTTCCCTCATCATCCACAC No data
Right 934745433 2:96756504-96756526 CACACCTGGTGTTCTCCCTCTGG No data
934745428_934745436 4 Left 934745428 2:96756486-96756508 CCTTCTTCCCTCATCATCCACAC No data
Right 934745436 2:96756513-96756535 TGTTCTCCCTCTGGAAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934745428 Original CRISPR GTGTGGATGATGAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr