ID: 934745435

View in Genome Browser
Species Human (GRCh38)
Location 2:96756512-96756534
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934745426_934745435 7 Left 934745426 2:96756482-96756504 CCTCCCTTCTTCCCTCATCATCC No data
Right 934745435 2:96756512-96756534 GTGTTCTCCCTCTGGAAGAAAGG No data
934745425_934745435 13 Left 934745425 2:96756476-96756498 CCTCAGCCTCCCTTCTTCCCTCA No data
Right 934745435 2:96756512-96756534 GTGTTCTCCCTCTGGAAGAAAGG No data
934745420_934745435 27 Left 934745420 2:96756462-96756484 CCAGGTGGCCTCCCCCTCAGCCT No data
Right 934745435 2:96756512-96756534 GTGTTCTCCCTCTGGAAGAAAGG No data
934745427_934745435 4 Left 934745427 2:96756485-96756507 CCCTTCTTCCCTCATCATCCACA No data
Right 934745435 2:96756512-96756534 GTGTTCTCCCTCTGGAAGAAAGG No data
934745428_934745435 3 Left 934745428 2:96756486-96756508 CCTTCTTCCCTCATCATCCACAC No data
Right 934745435 2:96756512-96756534 GTGTTCTCCCTCTGGAAGAAAGG No data
934745430_934745435 -4 Left 934745430 2:96756493-96756515 CCCTCATCATCCACACCTGGTGT No data
Right 934745435 2:96756512-96756534 GTGTTCTCCCTCTGGAAGAAAGG No data
934745431_934745435 -5 Left 934745431 2:96756494-96756516 CCTCATCATCCACACCTGGTGTT No data
Right 934745435 2:96756512-96756534 GTGTTCTCCCTCTGGAAGAAAGG No data
934745424_934745435 14 Left 934745424 2:96756475-96756497 CCCTCAGCCTCCCTTCTTCCCTC No data
Right 934745435 2:96756512-96756534 GTGTTCTCCCTCTGGAAGAAAGG No data
934745422_934745435 16 Left 934745422 2:96756473-96756495 CCCCCTCAGCCTCCCTTCTTCCC No data
Right 934745435 2:96756512-96756534 GTGTTCTCCCTCTGGAAGAAAGG No data
934745423_934745435 15 Left 934745423 2:96756474-96756496 CCCCTCAGCCTCCCTTCTTCCCT No data
Right 934745435 2:96756512-96756534 GTGTTCTCCCTCTGGAAGAAAGG No data
934745421_934745435 19 Left 934745421 2:96756470-96756492 CCTCCCCCTCAGCCTCCCTTCTT No data
Right 934745435 2:96756512-96756534 GTGTTCTCCCTCTGGAAGAAAGG No data
934745419_934745435 28 Left 934745419 2:96756461-96756483 CCCAGGTGGCCTCCCCCTCAGCC No data
Right 934745435 2:96756512-96756534 GTGTTCTCCCTCTGGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr