ID: 934745439

View in Genome Browser
Species Human (GRCh38)
Location 2:96756538-96756560
Sequence GAAAATGAACGAGAAGACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934745431_934745439 21 Left 934745431 2:96756494-96756516 CCTCATCATCCACACCTGGTGTT No data
Right 934745439 2:96756538-96756560 GAAAATGAACGAGAAGACTGTGG No data
934745438_934745439 -5 Left 934745438 2:96756520-96756542 CCTCTGGAAGAAAGGGAAGAAAA No data
Right 934745439 2:96756538-96756560 GAAAATGAACGAGAAGACTGTGG No data
934745432_934745439 12 Left 934745432 2:96756503-96756525 CCACACCTGGTGTTCTCCCTCTG No data
Right 934745439 2:96756538-96756560 GAAAATGAACGAGAAGACTGTGG No data
934745434_934745439 7 Left 934745434 2:96756508-96756530 CCTGGTGTTCTCCCTCTGGAAGA No data
Right 934745439 2:96756538-96756560 GAAAATGAACGAGAAGACTGTGG No data
934745427_934745439 30 Left 934745427 2:96756485-96756507 CCCTTCTTCCCTCATCATCCACA No data
Right 934745439 2:96756538-96756560 GAAAATGAACGAGAAGACTGTGG No data
934745428_934745439 29 Left 934745428 2:96756486-96756508 CCTTCTTCCCTCATCATCCACAC No data
Right 934745439 2:96756538-96756560 GAAAATGAACGAGAAGACTGTGG No data
934745437_934745439 -4 Left 934745437 2:96756519-96756541 CCCTCTGGAAGAAAGGGAAGAAA No data
Right 934745439 2:96756538-96756560 GAAAATGAACGAGAAGACTGTGG No data
934745430_934745439 22 Left 934745430 2:96756493-96756515 CCCTCATCATCCACACCTGGTGT No data
Right 934745439 2:96756538-96756560 GAAAATGAACGAGAAGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934745439 Original CRISPR GAAAATGAACGAGAAGACTG TGG Intergenic
No off target data available for this crispr