ID: 934748668

View in Genome Browser
Species Human (GRCh38)
Location 2:96777314-96777336
Sequence CGGCCTGTTGCCTGTTTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 139}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934748658_934748668 24 Left 934748658 2:96777267-96777289 CCTCGGCCTCCCAAAGTGCTGGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
Right 934748668 2:96777314-96777336 CGGCCTGTTGCCTGTTTTCTAGG 0: 1
1: 0
2: 1
3: 15
4: 139
934748662_934748668 15 Left 934748662 2:96777276-96777298 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 934748668 2:96777314-96777336 CGGCCTGTTGCCTGTTTTCTAGG 0: 1
1: 0
2: 1
3: 15
4: 139
934748655_934748668 28 Left 934748655 2:96777263-96777285 CCCGCCTCGGCCTCCCAAAGTGC 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
Right 934748668 2:96777314-96777336 CGGCCTGTTGCCTGTTTTCTAGG 0: 1
1: 0
2: 1
3: 15
4: 139
934748660_934748668 18 Left 934748660 2:96777273-96777295 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 934748668 2:96777314-96777336 CGGCCTGTTGCCTGTTTTCTAGG 0: 1
1: 0
2: 1
3: 15
4: 139
934748656_934748668 27 Left 934748656 2:96777264-96777286 CCGCCTCGGCCTCCCAAAGTGCT 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
Right 934748668 2:96777314-96777336 CGGCCTGTTGCCTGTTTTCTAGG 0: 1
1: 0
2: 1
3: 15
4: 139
934748663_934748668 14 Left 934748663 2:96777277-96777299 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 934748668 2:96777314-96777336 CGGCCTGTTGCCTGTTTTCTAGG 0: 1
1: 0
2: 1
3: 15
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934748668 Original CRISPR CGGCCTGTTGCCTGTTTTCT AGG Intronic
900727849 1:4230055-4230077 AGGCCTGTCCCCTGGTTTCTGGG + Intergenic
904491636 1:30863977-30863999 CAGCCTCTTGCATTTTTTCTAGG + Intergenic
904719464 1:32497071-32497093 CTGCTTGCTGCCTGTTTTTTTGG + Intronic
906334073 1:44913479-44913501 GGCCCTGTTGCCTGTTTTAATGG + Intronic
909259060 1:73463831-73463853 AGGCCTGTAGCCTCTTTTCATGG + Intergenic
919018936 1:192078040-192078062 TGGCCTTTTCCCTGATTTCTGGG - Intergenic
919403288 1:197146594-197146616 GGGCTTGTTTTCTGTTTTCTAGG - Exonic
922290171 1:224203270-224203292 TGGCCTGCTGCCTGTGTTCCTGG - Intergenic
924027134 1:239845760-239845782 CAGCCTCTGGCCTGTTTTCATGG + Intronic
1065970200 10:30799904-30799926 TGCACTGTTGCCTTTTTTCTGGG - Intergenic
1066253297 10:33654719-33654741 AGGCCTGTTAACTGTCTTCTAGG + Intergenic
1068201204 10:53786526-53786548 GGTCCTGATGACTGTTTTCTTGG + Intergenic
1069997543 10:72351989-72352011 AGGCCTGGTGCCTCTTTTCCAGG + Intronic
1071992696 10:91115388-91115410 AGGCCTATTGCCTTGTTTCTTGG - Intergenic
1072296063 10:94010391-94010413 AGGCCTTTTTCCTGTTGTCTAGG + Intronic
1078988238 11:16615020-16615042 GGGCCTGTTGCTTCTTTTATTGG - Intronic
1079777170 11:24546348-24546370 CTGTCTGTTGCCAGTTTTCAAGG + Intronic
1088546550 11:110965248-110965270 CAGCATGTTCCATGTTTTCTTGG - Intergenic
1089714478 11:120344598-120344620 CAGCCTATTTCCTGTTTTATTGG + Intronic
1091645736 12:2270978-2271000 TGGCCTGTTGCTTGCTCTCTAGG + Intronic
1095115824 12:38350952-38350974 CAGCTTGATGCCTGTATTCTAGG - Intergenic
1097953683 12:65461421-65461443 AGGCCTGTTTCATATTTTCTAGG + Intronic
1101369852 12:104116767-104116789 TGCCTTATTGCCTGTTTTCTGGG - Intergenic
1102584311 12:113912436-113912458 CTCTCTGCTGCCTGTTTTCTTGG - Intronic
1103691182 12:122775407-122775429 CGGCTTACTGCCTGTTTTCCTGG + Intronic
1103964138 12:124627358-124627380 TGGCCTGTTGCCTGGTTTGTAGG + Intergenic
1104666925 12:130654017-130654039 AGGCCTGTTTCCTGTTGTCTTGG + Intronic
1105260374 13:18774682-18774704 AGGCCTTTTCCCTGTTATCTTGG + Intergenic
1106145719 13:27048152-27048174 AGGCATGTTGAGTGTTTTCTTGG - Intergenic
1111100434 13:83577873-83577895 CGGCCTGTTTCCTTCTTTTTTGG - Intergenic
1112264908 13:97914543-97914565 CAGCCTCTTGACTGCTTTCTTGG + Intergenic
1115296973 14:31839631-31839653 CACCCTGTTGATTGTTTTCTTGG - Intronic
1115741939 14:36397941-36397963 GGGCCTGTTGCCCATATTCTAGG + Intergenic
1118991514 14:70801167-70801189 CGGCAAGTTGTCTGTTTACTGGG + Intronic
1120303694 14:82740122-82740144 CTGCCTGTTGTCTGTCTTCTTGG + Intergenic
1121048147 14:90802841-90802863 CGGCCTTATCCATGTTTTCTAGG - Intronic
1121431187 14:93889553-93889575 TGGTCTGTTGCCTGTGTTCAGGG + Intergenic
1122564722 14:102644747-102644769 CCTCCTGTTTCCTCTTTTCTGGG - Intronic
1124700343 15:31907067-31907089 CGGCCTGTGACCTGGCTTCTGGG + Intergenic
1128908645 15:71492080-71492102 GGGCATGTTAGCTGTTTTCTCGG + Intronic
1129517232 15:76164159-76164181 CGGCTTTTAGCATGTTTTCTCGG + Intronic
1136663717 16:31789752-31789774 GGGCCTGTTGACTGTCATCTTGG + Intronic
1137454377 16:48607219-48607241 CTGCCCAATGCCTGTTTTCTTGG - Intronic
1137790325 16:51169715-51169737 GGTCCTGTTGCATCTTTTCTGGG - Intergenic
1137804950 16:51296339-51296361 TCTCCTGTTTCCTGTTTTCTGGG + Intergenic
1138617828 16:58185203-58185225 TGCCCTGTGGCCTGTTTCCTAGG - Intronic
1139176670 16:64697858-64697880 CAGCCTGTGGCCTGTATTATTGG - Intergenic
1139973473 16:70790874-70790896 CTGCCTGACGCCTGTTTTCCTGG - Intronic
1141188737 16:81808275-81808297 AGGCCTGTTGGCTGTTTTGGAGG + Intronic
1141607068 16:85159979-85160001 CGGCCTGCTGCTTGTTTGCTTGG + Intergenic
1148241887 17:46004712-46004734 AGGCTTGTTGCCTTTTTTGTGGG + Intronic
1152899144 17:82930028-82930050 CGTCCTGTTACGTGTTTTCTAGG - Intronic
1153211145 18:2766288-2766310 CGGCCTGTCTCCAGTTTTCTTGG + Intronic
1154966054 18:21357439-21357461 CGCCCTGTTGATTGTTTCCTTGG + Intronic
1157578763 18:48761193-48761215 CTCCTTGTTGCCTTTTTTCTTGG - Intronic
1157770272 18:50339569-50339591 TGGCCTGCTCCCTGTTTTCAAGG - Intergenic
1161558324 19:4956945-4956967 GGCCCTGTTGACTGCTTTCTGGG + Intronic
1162925904 19:13930418-13930440 GGGCCTGCTGCCCGCTTTCTGGG - Exonic
1163441876 19:17326190-17326212 CTGTCTCTTGCCTGTTCTCTGGG - Intronic
1164041148 19:21493748-21493770 CTGCCTGGTGCCTGTTCTCAGGG + Intergenic
1166037427 19:40179117-40179139 CGGCCTCTTGCATCTTTCCTTGG + Intergenic
925671421 2:6313847-6313869 TGTCCTGTGGCCAGTTTTCTCGG - Intergenic
926009598 2:9397639-9397661 CAGCCTGCTGCCTGTTTTTTAGG + Intronic
926221509 2:10938652-10938674 AGGCCTTTTTCCTGTTTTCTGGG + Intergenic
927297806 2:21475306-21475328 CAGTATGTTGCCTGTTCTCTCGG + Intergenic
928470714 2:31573090-31573112 TGGCCTGTTCCCAGATTTCTGGG - Intronic
931785389 2:65613432-65613454 CAGCCTGCTGTCTGTTCTCTAGG - Intergenic
934564750 2:95332149-95332171 CGGCCTTTTGCCTGTGCTCCTGG - Intronic
934748668 2:96777314-96777336 CGGCCTGTTGCCTGTTTTCTAGG + Intronic
935364725 2:102277332-102277354 AGTCTTGTTGCCTGTTTGCTAGG + Intergenic
936562646 2:113554930-113554952 ATGCCTGTTTCCTGTCTTCTCGG - Intergenic
937433332 2:121859563-121859585 TTGCCTGTTTCCTGGTTTCTTGG + Intergenic
938859065 2:135347577-135347599 CGGCCTGTTTTCAGTTCTCTTGG + Intronic
940405951 2:153302527-153302549 CAGTCTGTTGATTGTTTTCTTGG + Intergenic
943050411 2:182907173-182907195 AGGCCGGTTGCCTTTCTTCTTGG + Intergenic
943326046 2:186499200-186499222 CAGCCTCTTGCCTTTATTCTTGG + Intronic
943965561 2:194327889-194327911 CGGCCTGATGCCTGGGGTCTAGG + Intergenic
1169135179 20:3192949-3192971 CTGCCTGATCCCTGTTTTGTAGG - Intronic
1169365624 20:4989962-4989984 CGGTCTGTTGGCTGTATTTTAGG - Intronic
1178030051 21:28515077-28515099 CAGCCTGTTGCATATTTGCTTGG - Intergenic
1180054046 21:45347981-45348003 CGTCCTGGTGCCTCTCTTCTGGG - Intergenic
1182347299 22:29675153-29675175 GGCCCTGTTGCCTGTTATCCAGG - Intronic
1183229215 22:36570460-36570482 CGGCCTGTTGCCTTCTTTCTGGG - Intronic
951385382 3:22035687-22035709 TGGCCCATTGCTTGTTTTCTAGG - Intronic
953563429 3:44012284-44012306 CTGCCTGTGGCATGTTTTTTGGG + Intergenic
955840056 3:63103030-63103052 CTGCCTCTTGCCTCTCTTCTTGG - Intergenic
957482657 3:80818365-80818387 AGGCTTGTGGCCTTTTTTCTGGG - Intergenic
958146213 3:89629039-89629061 TGGCCACTTGCCTGGTTTCTTGG + Intergenic
962393312 3:134992266-134992288 CGGCCTGGAGTCTGTTTTCAGGG + Intronic
962732801 3:138299132-138299154 CTGCCCCTTGCCTGTTTACTGGG + Intronic
966453631 3:180090997-180091019 AGGTCTGTGGCCTGATTTCTGGG + Intergenic
966591443 3:181687896-181687918 TGGCCTGTGGCCTGATTTCCTGG + Intergenic
968475959 4:808617-808639 CTGCCTGATGCCTGTTTTATGGG - Intronic
970192108 4:13527253-13527275 CGGTTTTTTGCCTATTTTCTAGG + Intergenic
978704398 4:111689437-111689459 CTGTCTGTTGCCTTTTTACTTGG - Intergenic
981844512 4:149152272-149152294 CTGTCTGTTTCCTGTTTTCCTGG - Intergenic
982064619 4:151642786-151642808 GGGCCTGTTTCTTATTTTCTTGG - Intronic
984938200 4:184908232-184908254 CTGCCAGTTGTTTGTTTTCTGGG - Intergenic
985342237 4:188967629-188967651 CGGCCTGTTTCCACTTTTATAGG - Intergenic
986316192 5:6588785-6588807 TGGCCTAGTGCCTCTTTTCTTGG + Intergenic
993806634 5:92418746-92418768 AGGCCTGTTGCCACTTTCCTCGG + Intergenic
996008967 5:118459328-118459350 TGGCCTTTTGCCTCTTTCCTGGG - Intergenic
996556865 5:124787063-124787085 TGGCCTGTTTACTGTTTTGTGGG + Intergenic
996729708 5:126705259-126705281 TGGCATGTTTCCTGTTTTATTGG - Intergenic
997419040 5:133751228-133751250 GGGCCTGTGTCCTGTTTCCTGGG - Intergenic
999549327 5:152668058-152668080 CACCCTGTTGATTGTTTTCTTGG - Intergenic
1001932654 5:175684220-175684242 CTTCCTGTTGCCTGGGTTCTCGG - Exonic
1003730862 6:8822198-8822220 CAACCTCTTGCCTGTATTCTGGG - Intergenic
1005326721 6:24708992-24709014 CGGACTGTTGGCTGCTTTATTGG - Intronic
1007925263 6:45644841-45644863 CCTCCTGCTGCCTGCTTTCTTGG - Intronic
1009400997 6:63255662-63255684 CGGCCTATTGCCAGTTGTCTAGG - Intergenic
1010061377 6:71626385-71626407 CGGCCTTTTTCCTCTTTGCTTGG + Intergenic
1010396607 6:75400148-75400170 TGACCTGTTTCCTGTTTCCTTGG + Intronic
1011348790 6:86400100-86400122 AGGCCTTTTCCCCGTTTTCTTGG + Intergenic
1013043627 6:106461636-106461658 CAGCCAGTGGCCTTTTTTCTTGG - Intergenic
1013312771 6:108912713-108912735 GGGCCTGGTGCCTGTTGTCCTGG + Intronic
1021653180 7:22851202-22851224 CTGCCTGTCACCTGTTTTCAAGG - Intergenic
1021675933 7:23080950-23080972 CTGCCTTTTTCCTGTTTTCATGG - Intergenic
1029897527 7:104000145-104000167 GTGCCTGTGGCCTCTTTTCTGGG + Intergenic
1030112568 7:106039122-106039144 AGGCCTGTTTCCTGTTTCCTTGG - Intergenic
1032057325 7:128694083-128694105 GGGCGTGGTGCCTGTTTTCAAGG + Intergenic
1032498451 7:132380593-132380615 AGGACTGCTGTCTGTTTTCTGGG - Intronic
1034378529 7:150667922-150667944 TGGTCTGTTGCCTGTTATCTTGG - Intergenic
1034824908 7:154253157-154253179 GAGACTGTTGCCTTTTTTCTTGG - Intronic
1035861106 8:3028451-3028473 CTGCCTGAAGCCTGTTTTCCAGG - Intronic
1035870547 8:3132857-3132879 CTTCCTGTTTCCTGTTTCCTAGG - Intronic
1036533136 8:9616056-9616078 CTGCCTGCTGCCTTATTTCTTGG + Intronic
1038339711 8:26675046-26675068 CCTCCTGTTGCCTGTTTCTTAGG + Intergenic
1040511877 8:48103358-48103380 CAGCCTCTTTCCTCTTTTCTCGG - Intergenic
1042050210 8:64695733-64695755 CAGCCTGTTTCATGTTCTCTTGG + Intronic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1045294299 8:100860397-100860419 CGGCCTCCTGTCTGTCTTCTGGG - Intergenic
1049516640 8:143062368-143062390 CGGCCTCTTGTGTATTTTCTTGG - Intergenic
1049890087 9:60767-60789 ATGCCTGTTTCCTGTCTTCTCGG + Intergenic
1050286546 9:4108653-4108675 GGGCCTGTTGCTTGTGTTTTTGG - Intronic
1051319236 9:15882831-15882853 GTGCCTGTTGTCTGATTTCTAGG + Intronic
1051340524 9:16105927-16105949 CTGCCAGTGGCCTGTTTTCTTGG - Intergenic
1052298052 9:26920900-26920922 CGGCCTCTTTCCTGTACTCTTGG + Intronic
1052879046 9:33589307-33589329 AGGCCTTTTCCCTGTTGTCTTGG - Intergenic
1053496930 9:38554912-38554934 AGGCCTTTTCCCTGTTGTCTTGG + Intronic
1053503991 9:38624914-38624936 AGGCCTGTTGCTTTCTTTCTTGG + Intergenic
1053731562 9:41062043-41062065 ATGCCTGTTTCCTGTCTTCTCGG + Intergenic
1053914367 9:42934570-42934592 CGGCCTTTTCCTTATTTTCTTGG + Intergenic
1054696948 9:68370052-68370074 ATGCCTGTTTCCTGTCTTCTCGG - Intronic
1054917832 9:70512011-70512033 CGCTCTGTTGCCTGTTGTCCTGG + Intergenic
1055097220 9:72425685-72425707 CAGCCAGTTGTCTGTTTTATAGG + Intergenic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1056464591 9:86841352-86841374 CAGGCTGTTTCCTGTTTTGTGGG - Intergenic
1056586240 9:87929240-87929262 AGGCCTTTTCCCTGTTGTCTTGG - Intergenic
1056610642 9:88123703-88123725 AGGCCTTTTCCCTGTTGTCTTGG + Intergenic
1057676050 9:97136950-97136972 AGGCCTTTTCCCTGTTGTCTTGG - Intergenic
1060656880 9:125378078-125378100 CGGCCTGCTGCCTCCATTCTAGG + Intergenic
1062730336 9:138104943-138104965 CAGCCTGTTGCCAGTTTTCAGGG - Intronic
1195346760 X:103958234-103958256 TGTCTTGTTGCCTGTTTTCAAGG - Intronic
1195360682 X:104080607-104080629 TGTCTTGTTGCCTGTTTTCAAGG + Intergenic
1198569285 X:137938106-137938128 AGGCCTTTTCCCTGTTTTCTTGG + Intergenic