ID: 934750088

View in Genome Browser
Species Human (GRCh38)
Location 2:96788586-96788608
Sequence GCTTAATCCTGCGGGAGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 57}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934750082_934750088 10 Left 934750082 2:96788553-96788575 CCCGGTGGTTGAGGTCAGCACTA 0: 1
1: 0
2: 0
3: 7
4: 108
Right 934750088 2:96788586-96788608 GCTTAATCCTGCGGGAGCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 57
934750081_934750088 18 Left 934750081 2:96788545-96788567 CCACTCATCCCGGTGGTTGAGGT 0: 1
1: 0
2: 0
3: 2
4: 75
Right 934750088 2:96788586-96788608 GCTTAATCCTGCGGGAGCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 57
934750083_934750088 9 Left 934750083 2:96788554-96788576 CCGGTGGTTGAGGTCAGCACTAT 0: 1
1: 0
2: 1
3: 4
4: 77
Right 934750088 2:96788586-96788608 GCTTAATCCTGCGGGAGCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934750088 Original CRISPR GCTTAATCCTGCGGGAGCTT GGG Intronic