ID: 934751575

View in Genome Browser
Species Human (GRCh38)
Location 2:96797375-96797397
Sequence GCTCTGGCTGGCAGGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 1, 2: 3, 3: 33, 4: 402}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934751575_934751584 1 Left 934751575 2:96797375-96797397 CCCAGGACCCTGCCAGCCAGAGC 0: 1
1: 1
2: 3
3: 33
4: 402
Right 934751584 2:96797399-96797421 TGCTGCTCCTGCGTGGGACTAGG 0: 1
1: 1
2: 2
3: 18
4: 181
934751575_934751589 15 Left 934751575 2:96797375-96797397 CCCAGGACCCTGCCAGCCAGAGC 0: 1
1: 1
2: 3
3: 33
4: 402
Right 934751589 2:96797413-96797435 GGGACTAGGGGCTGGAGAGCAGG 0: 1
1: 0
2: 7
3: 89
4: 816
934751575_934751590 23 Left 934751575 2:96797375-96797397 CCCAGGACCCTGCCAGCCAGAGC 0: 1
1: 1
2: 3
3: 33
4: 402
Right 934751590 2:96797421-96797443 GGGCTGGAGAGCAGGAGCTGCGG 0: 1
1: 0
2: 14
3: 144
4: 1028
934751575_934751585 2 Left 934751575 2:96797375-96797397 CCCAGGACCCTGCCAGCCAGAGC 0: 1
1: 1
2: 3
3: 33
4: 402
Right 934751585 2:96797400-96797422 GCTGCTCCTGCGTGGGACTAGGG 0: 1
1: 0
2: 0
3: 11
4: 107
934751575_934751587 7 Left 934751575 2:96797375-96797397 CCCAGGACCCTGCCAGCCAGAGC 0: 1
1: 1
2: 3
3: 33
4: 402
Right 934751587 2:96797405-96797427 TCCTGCGTGGGACTAGGGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 148
934751575_934751592 25 Left 934751575 2:96797375-96797397 CCCAGGACCCTGCCAGCCAGAGC 0: 1
1: 1
2: 3
3: 33
4: 402
Right 934751592 2:96797423-96797445 GCTGGAGAGCAGGAGCTGCGGGG 0: 1
1: 0
2: 4
3: 63
4: 758
934751575_934751581 -6 Left 934751575 2:96797375-96797397 CCCAGGACCCTGCCAGCCAGAGC 0: 1
1: 1
2: 3
3: 33
4: 402
Right 934751581 2:96797392-96797414 CAGAGCCTGCTGCTCCTGCGTGG 0: 2
1: 1
2: 0
3: 40
4: 282
934751575_934751594 29 Left 934751575 2:96797375-96797397 CCCAGGACCCTGCCAGCCAGAGC 0: 1
1: 1
2: 3
3: 33
4: 402
Right 934751594 2:96797427-96797449 GAGAGCAGGAGCTGCGGGGCGGG 0: 1
1: 1
2: 3
3: 61
4: 709
934751575_934751586 3 Left 934751575 2:96797375-96797397 CCCAGGACCCTGCCAGCCAGAGC 0: 1
1: 1
2: 3
3: 33
4: 402
Right 934751586 2:96797401-96797423 CTGCTCCTGCGTGGGACTAGGGG 0: 1
1: 0
2: 0
3: 14
4: 136
934751575_934751593 28 Left 934751575 2:96797375-96797397 CCCAGGACCCTGCCAGCCAGAGC 0: 1
1: 1
2: 3
3: 33
4: 402
Right 934751593 2:96797426-96797448 GGAGAGCAGGAGCTGCGGGGCGG 0: 1
1: 0
2: 6
3: 93
4: 706
934751575_934751591 24 Left 934751575 2:96797375-96797397 CCCAGGACCCTGCCAGCCAGAGC 0: 1
1: 1
2: 3
3: 33
4: 402
Right 934751591 2:96797422-96797444 GGCTGGAGAGCAGGAGCTGCGGG 0: 1
1: 0
2: 8
3: 79
4: 801
934751575_934751582 -5 Left 934751575 2:96797375-96797397 CCCAGGACCCTGCCAGCCAGAGC 0: 1
1: 1
2: 3
3: 33
4: 402
Right 934751582 2:96797393-96797415 AGAGCCTGCTGCTCCTGCGTGGG 0: 2
1: 0
2: 1
3: 15
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934751575 Original CRISPR GCTCTGGCTGGCAGGGTCCT GGG (reversed) Intronic