ID: 934752564

View in Genome Browser
Species Human (GRCh38)
Location 2:96802937-96802959
Sequence GATGCTGGTGCTGCTCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 876
Summary {0: 1, 1: 0, 2: 6, 3: 84, 4: 785}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934752564_934752572 28 Left 934752564 2:96802937-96802959 CCATCAGGAGCAGCACCAGCATC 0: 1
1: 0
2: 6
3: 84
4: 785
Right 934752572 2:96802988-96803010 AAAAACCCGTCACCTCAGCCCGG 0: 1
1: 0
2: 3
3: 5
4: 113
934752564_934752573 29 Left 934752564 2:96802937-96802959 CCATCAGGAGCAGCACCAGCATC 0: 1
1: 0
2: 6
3: 84
4: 785
Right 934752573 2:96802989-96803011 AAAACCCGTCACCTCAGCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 89
934752564_934752574 30 Left 934752564 2:96802937-96802959 CCATCAGGAGCAGCACCAGCATC 0: 1
1: 0
2: 6
3: 84
4: 785
Right 934752574 2:96802990-96803012 AAACCCGTCACCTCAGCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934752564 Original CRISPR GATGCTGGTGCTGCTCCTGA TGG (reversed) Intronic
900404385 1:2486059-2486081 CATGCTGGTGCCGCCCCTGGTGG - Intronic
900435640 1:2629379-2629401 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
900444202 1:2671809-2671831 GGTACTGGTGCTGCTCCGGGAGG - Intronic
900445108 1:2676465-2676487 GGTACTGGTGCTGCTCCGGGAGG - Intronic
900445817 1:2680199-2680221 GGTACTGGTGCTGCTCCGGGAGG - Intronic
900746200 1:4362311-4362333 GAAGCTGGGGCTGCCCCTCATGG - Intergenic
900805821 1:4767733-4767755 GTTGCTGCTGCTGCTGCTGATGG - Intronic
900936238 1:5768026-5768048 GATGAGGGTGCTGGTCCTGGGGG - Intergenic
900945561 1:5829522-5829544 GATGATGGTGCTGGTAGTGATGG + Intergenic
901194026 1:7430091-7430113 GCTGCTACTGCTGCTGCTGATGG + Intronic
901218495 1:7568315-7568337 GATGCTGGTGATCCTGATGAGGG - Intronic
901218519 1:7568523-7568545 GATGATGGTGATGCTGATGATGG - Intronic
901218645 1:7569732-7569754 GATGGTGATGCTGCTGCTGATGG - Intronic
901238722 1:7680861-7680883 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
901275865 1:7990435-7990457 GATGCTGGTGGTGATGGTGATGG - Intergenic
901670509 1:10853344-10853366 GATGGTGGTGATGGTGCTGATGG - Intergenic
901782365 1:11602432-11602454 GGTGCTGCTGCTGCTGCTGTTGG - Intergenic
901789004 1:11643766-11643788 GATGATGGTGATGATGCTGATGG - Intergenic
902516778 1:16993781-16993803 GATGGGGGTGGTGCCCCTGAAGG - Exonic
902582443 1:17416668-17416690 TGTGCTTGTGCTGCTGCTGATGG - Intronic
902681847 1:18049197-18049219 GCTGCTGCTGCTGCTGGTGATGG + Intergenic
902681853 1:18049239-18049261 GATGGTGATGCTGGTGCTGATGG + Intergenic
902681860 1:18049323-18049345 GATGATGGTGATGCTGGTGATGG + Intergenic
902681888 1:18049547-18049569 GATGCTGGTGATGGTGGTGATGG + Intergenic
902805406 1:18858280-18858302 GATGCTGATGATGGTGCTGATGG - Exonic
902862278 1:19254989-19255011 TTTGCTGGTGCTGCTGCTGGAGG - Intronic
903030915 1:20463746-20463768 GATGGTGGTGGTGCTTGTGATGG - Intergenic
903671116 1:25035943-25035965 GATGGTGGTGCTGGTAGTGATGG - Intergenic
903917289 1:26773688-26773710 GCTGCTGCTGCTGCTGCTGCGGG - Exonic
904037102 1:27564832-27564854 GGTGCTGCTGCTGGTCATGATGG - Intronic
904500098 1:30908463-30908485 GCTGCTGCTGCTGCTGCTGGCGG - Exonic
904853776 1:33479555-33479577 GATCCTGGAGCTGCTCGTGCTGG + Exonic
905178930 1:36155212-36155234 GATGATGGTGGTGCTGCTGCAGG - Intronic
905214376 1:36396600-36396622 GATGCTGATGCTGCTGGTCAGGG + Intronic
906711968 1:47937414-47937436 GATGATGGTGATGATCATGATGG - Intronic
907637914 1:56155329-56155351 GATGCTGGTGATGGTGATGACGG + Intergenic
907944057 1:59116913-59116935 GGTGCTGGGGCTCCTCTTGATGG + Intergenic
908953294 1:69588959-69588981 GTTGGTGCTGCTGCTCCTGCTGG + Intronic
909169880 1:72282205-72282227 AATGCTGGTGGTGCTCATCATGG - Intronic
909263354 1:73524217-73524239 GATGGTGGTGCTGGTGCTGGTGG - Intergenic
909488062 1:76196342-76196364 GATACTGATGCTGCTCCTCTGGG + Intronic
909548020 1:76868589-76868611 GCTGCTGCTGCTGCTGCTGCGGG - Exonic
909622502 1:77683511-77683533 GCTGCTGTTGCTGCTGCTGCAGG + Intergenic
910516780 1:88070190-88070212 GCTGCTGTTGCTGTTGCTGAAGG - Intergenic
912040783 1:105387435-105387457 GATTATGCTGCTGCTCCTGATGG + Intergenic
912366570 1:109138567-109138589 GCTGCTGCTGCTGCTGCTGGTGG - Intronic
912366571 1:109138570-109138592 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
912457476 1:109807542-109807564 GATGCTGGCTGTGCTCCTGCAGG + Intergenic
912659562 1:111515805-111515827 GATGCTGGTGCTGCGCCGGCCGG + Intronic
913482102 1:119298578-119298600 GAGGCAGGTGCTGTTCCTGGAGG + Intergenic
913531155 1:119735250-119735272 GATCCTGGTGCTGCCCCAGCAGG + Intronic
914779366 1:150770967-150770989 CCTGCTGGTGCTGCTGCTGCTGG - Intergenic
914779369 1:150770982-150771004 GCTGCTGCTCCTGCTCCTGCTGG - Intergenic
915244073 1:154543969-154543991 CTTCCTGGTGCTGCTCCTGAGGG + Exonic
916059536 1:161089230-161089252 GCTGCTGCTGCTGCTACTGCTGG - Exonic
916619185 1:166477247-166477269 GCTGCTGCTGCTGCTACTGCCGG + Intergenic
916658150 1:166896302-166896324 GGTGCTGGTGCTGCTGCTGTTGG + Intergenic
916886234 1:169071169-169071191 GGTGGTGGTGCTGCTCCTGGTGG + Intergenic
917683546 1:177392458-177392480 GGTGCTGCTGCTGCTGCTGTTGG + Intergenic
918225520 1:182477694-182477716 GAAGCTGGAGCTGCACCTGTGGG - Intronic
918392913 1:184084950-184084972 GCTGCTGTTGCTGCTGCTAATGG + Intergenic
919730981 1:200913413-200913435 GCTGCTGCTGCTGCTTCTGCTGG + Intronic
920650195 1:207831840-207831862 GACGCTGCTGCTGCTCTTGTGGG + Intergenic
920707821 1:208267465-208267487 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
920760807 1:208782096-208782118 GATGCTGGTGCTGGCCATGATGG + Intergenic
921725090 1:218514718-218514740 GATGCTGCTGCTGCTGCTCCAGG + Intergenic
922107359 1:222524109-222524131 GATTCTGCTGCTGCTTCTGATGG + Intronic
922327742 1:224544676-224544698 GCTGCTGAGGCTGCTGCTGATGG + Intronic
922337945 1:224632901-224632923 GGGGCTGGTGGTGCTGCTGAGGG + Intronic
922785503 1:228280531-228280553 GAAGCCGGTGGTGTTCCTGAAGG + Exonic
922866988 1:228868736-228868758 GCTGCTGCTGCTGCTGCTGCTGG + Intergenic
922866989 1:228868739-228868761 GCTGCTGCTGCTGCTGCTGGTGG + Intergenic
922879672 1:228971144-228971166 GCTGCTGCTGCTGCTGCTGGTGG + Intergenic
924052518 1:240092721-240092743 GCTGCTGCTGCTGCTGCTGCAGG - Exonic
924568239 1:245215454-245215476 GAAGCAGATGCTGCTCCTCAGGG + Intronic
924603661 1:245513747-245513769 AATGCAGGTGCTGTTCCTCAGGG - Intronic
924624258 1:245686666-245686688 GATGCTGCTGATGATGCTGACGG - Exonic
924672847 1:246147248-246147270 GAAGCTGCTGCCGTTCCTGAAGG - Intronic
1063136522 10:3221633-3221655 GATGCTGGTGATGGTGGTGATGG - Intergenic
1063136901 10:3225231-3225253 GATGCTGGTGATGGTGGTGATGG + Intergenic
1063352999 10:5373747-5373769 GCTCCTGCTGCTGCTCCTGGGGG + Exonic
1063361886 10:5466256-5466278 GATCAGGGTGCTGCTGCTGAAGG - Intergenic
1063424781 10:5942466-5942488 GATGGTGGTGCTGTTTCTGGAGG - Intronic
1063444568 10:6102427-6102449 GGAGCGGGTGCTGTTCCTGAGGG + Intronic
1065540702 10:26763918-26763940 GGTGCTGGTGGAGCTCCAGAAGG + Exonic
1067432773 10:46254773-46254795 GATGCTGGTCCTGGGCCTCAGGG - Intergenic
1067434463 10:46267026-46267048 GATGCTGGGACTGATCCTGTGGG + Intergenic
1067590150 10:47502196-47502218 GGTCCTGGAGCAGCTCCTGACGG - Exonic
1067724483 10:48759549-48759571 GCTGCTGTTGCTGATGCTGAGGG + Intronic
1068053532 10:51982794-51982816 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
1069287887 10:66739347-66739369 GATGCTGATGCTGCTGCTCTGGG + Intronic
1069415338 10:68195636-68195658 GATGCTAGTGCTGCAAGTGAAGG - Intronic
1069879678 10:71583954-71583976 GATGCTGATGCTGCTGCTCTGGG - Intronic
1071358021 10:84817949-84817971 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
1071402019 10:85282590-85282612 GATGCTGATGCTGCTGCTCCAGG - Intergenic
1071488227 10:86117375-86117397 GATGTTGGTGTTGATCATGATGG - Intronic
1071509807 10:86254360-86254382 GATGCTGGTGCTGCTGGTCTGGG - Intronic
1072743747 10:97925961-97925983 GATGATGCTTCTGCTCCTGTGGG - Intronic
1073027979 10:100502253-100502275 GATGCTGTGGCAGTTCCTGAAGG - Exonic
1073139028 10:101235778-101235800 GAGTCTGGTTCTGTTCCTGATGG + Intergenic
1073634931 10:105187984-105188006 GGTGGTGGTGCTGCTGCTGCTGG + Intronic
1074002863 10:109389977-109389999 GGTGCTGGTGCTGCTTCAAAGGG - Intergenic
1074313757 10:112344052-112344074 GATGATGGTGCCCCTTCTGAAGG - Intergenic
1074430998 10:113394572-113394594 GATGCTGTTGCTGCTAATCAGGG + Intergenic
1074579339 10:114703539-114703561 GATCCTGGTGCTGCCACTGTAGG - Intergenic
1074913051 10:117929282-117929304 GCTGCTGGTGATGCTGATGAAGG - Intergenic
1075088064 10:119426832-119426854 GATGGTGGTGATGCTGATGATGG - Intronic
1075088068 10:119426886-119426908 GATGGTGGTGATGCTGTTGATGG - Intronic
1075088081 10:119427029-119427051 GATGGTGGTGATGCTGCTGATGG - Intronic
1075088108 10:119427365-119427387 GATGGTGGTGATGCTGATGATGG - Intronic
1075088116 10:119427455-119427477 GATGGTGGTGATGCTGATGATGG - Intronic
1075088121 10:119427509-119427531 GATGGCGGTGATGCTGCTGATGG - Intronic
1075088128 10:119427563-119427585 GATGGTGGTGATGCTGATGATGG - Intronic
1075088137 10:119427691-119427713 GATGGTGGTGATGCTGTTGATGG - Intronic
1075088145 10:119427763-119427785 GATGGTGGTGATGCCGCTGATGG - Intronic
1075088147 10:119427781-119427803 GATGGTGGTGATGCTGATGATGG - Intronic
1075088149 10:119427799-119427821 GATGGTGGTGATGCTGTTGATGG - Intronic
1075438474 10:122461682-122461704 GCTGCTGCTGCTGCTGCTGGCGG + Exonic
1076079671 10:127567668-127567690 GCTGCTGCTGCTACTGCTGATGG - Intergenic
1076312020 10:129515265-129515287 GCCGCAGCTGCTGCTCCTGACGG - Intronic
1076473760 10:130738298-130738320 GATGCTGTTTCCACTCCTGACGG - Intergenic
1076592204 10:131591243-131591265 GATGATGGTGATGCTGGTGATGG - Intergenic
1077063342 11:627101-627123 GCTGCTGCTGCTGCTCCTCGGGG - Exonic
1077920974 11:6641511-6641533 GCTGCTGCTGCTGCTGCTGGGGG - Exonic
1077920977 11:6641514-6641536 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1078152908 11:8774544-8774566 GATGGTAGTGGTGCTACTGAAGG - Intronic
1078404622 11:11059400-11059422 GAGGCTGGTGCTGTTTCTGCTGG + Intergenic
1078449786 11:11432188-11432210 GATGATGGTGCTGGTGGTGATGG - Intronic
1078892793 11:15572602-15572624 GAAGCTGTTGCAGCCCCTGATGG - Intergenic
1080088108 11:28310895-28310917 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1080088109 11:28310898-28310920 GCTGCTGCTGCTGCTGCTGGTGG + Intronic
1080124973 11:28722322-28722344 GTTTCTGATGCTGCTGCTGAGGG - Intergenic
1081669872 11:44936986-44937008 GATGCTGATCCTGCTCCTGGCGG - Intronic
1081711123 11:45216153-45216175 GAAGGTGGTGGTGCTGCTGATGG - Intronic
1082912027 11:58388324-58388346 GATGATGCTGCTGATCCTGCTGG - Intergenic
1082914950 11:58423114-58423136 GATGATGTTGCTGATCCTGATGG - Exonic
1083479037 11:62932000-62932022 GAAGCAGGAGCTGCTCCTGTGGG - Intergenic
1083713818 11:64564528-64564550 GATGCTGGTGGTGGTGCTGGTGG - Intronic
1083716765 11:64581884-64581906 GATGGTGATGCTGCTGGTGACGG - Intergenic
1083716838 11:64582378-64582400 GATGGTGGCGCTGCTGCTGATGG - Intergenic
1083741448 11:64713639-64713661 GCTGCTGTTGCTGCTGCTGCTGG - Exonic
1083751713 11:64764516-64764538 GGTGCTGCTGCTGCTGCTGGTGG + Intergenic
1083883037 11:65557854-65557876 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1084310293 11:68312753-68312775 GCTGCTGCTGCTGCTGCTGCTGG + Exonic
1084468533 11:69341607-69341629 GAAGCAGGTGCTGCTGCTGTGGG - Intronic
1084697040 11:70761919-70761941 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1084701143 11:70786981-70787003 GATGCTGGTGGTGATGCTGGTGG - Intronic
1084701149 11:70787014-70787036 GATGATGGTGATGCTGGTGATGG - Intronic
1084701190 11:70787257-70787279 GATGGTGGTGATGCTGCTGGTGG - Intronic
1084701207 11:70787344-70787366 GATGCTGGTGGTGATGCTGGTGG - Intronic
1084701251 11:70787599-70787621 GATGCTGGTGGTGGTGCTCATGG - Intronic
1084730382 11:71069436-71069458 GATGGTGGTGGTGCTGATGATGG - Intronic
1086128682 11:83378009-83378031 GATACTGGTGATGTTCCTTAAGG + Intergenic
1086250088 11:84802365-84802387 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
1086338154 11:85820473-85820495 GATGCTGATGCTGCTTCTATGGG - Intergenic
1087268981 11:96092095-96092117 GTTGCTGCTGCTGCTGCTGTTGG + Exonic
1087272864 11:96129411-96129433 GATGCTGATGCTGCTCATCCAGG + Intronic
1087392054 11:97548439-97548461 GCTGCTGCTGCTGCTGCTGGGGG - Intergenic
1087402518 11:97684999-97685021 TAGGCTGCTGCTGCTGCTGAGGG + Intergenic
1088165194 11:106926867-106926889 GATTATTGTGCTGTTCCTGATGG - Intronic
1088269176 11:108016390-108016412 AATGCTGGTGTTGCACCTGTGGG - Intronic
1088887848 11:114021516-114021538 GATGCAGATGCTGCTGCTCAGGG - Intergenic
1088976606 11:114821846-114821868 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
1089219923 11:116862222-116862244 TTTGATGGTGCTGCTCCTGCTGG + Exonic
1089607201 11:119648357-119648379 GATGCTGGTGATGGTGGTGATGG + Intronic
1090235020 11:125140588-125140610 GCTGCTGCTGCTGCTGCTGCTGG + Intergenic
1091153775 11:133354216-133354238 GATGCTGGTGCTGGTGGTGATGG + Intronic
1091215732 11:133900320-133900342 GAAGCTGGTGCTGGGCCAGATGG - Intergenic
1091606157 12:1953165-1953187 GCTGCTGCTGCTGCTGCTGCTGG + Exonic
1091606158 12:1953168-1953190 GCTGCTGCTGCTGCTGCTGGTGG + Exonic
1091859164 12:3764036-3764058 GAATCTGGTGAGGCTCCTGAAGG - Intronic
1092035380 12:5329977-5329999 GATGCTGGTGCTGCTGGTTCAGG + Intergenic
1092282567 12:7108926-7108948 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1093182180 12:15979292-15979314 ACTGCTGGTGCTGCTCCTACTGG + Intronic
1093258142 12:16898353-16898375 GATGCTGGAGATGCTCCCAAGGG + Intergenic
1093677347 12:21958912-21958934 GATTCTGGTGCTTCTGATGAAGG - Intergenic
1095092315 12:38118748-38118770 GATGATGGTGCTGATGGTGATGG + Intergenic
1095189191 12:39236297-39236319 GATGCTGGTGCTGCTAGTTCAGG + Intergenic
1096043813 12:48544352-48544374 GCTGCTGCTGCTGCTGCAGACGG - Intergenic
1096112433 12:49037515-49037537 GCTGCTGTTGCTGCTGCTGCTGG + Exonic
1096563266 12:52452037-52452059 GCTGCTGCTGTGGCTCCTGATGG + Exonic
1096565418 12:52473696-52473718 GCTGCTGCTGTGGCTCCTGATGG + Exonic
1096567438 12:52493147-52493169 GCTGCTGCTGTGGCTCCTGATGG + Exonic
1096707185 12:53429657-53429679 GATGATGTTGGTGCTGCTGATGG + Intronic
1097088607 12:56487938-56487960 GATCCTGGTGCTGCGGCTGGTGG + Exonic
1097483510 12:60163250-60163272 GCTGCTGCTGCTGCTGCTGTGGG - Intergenic
1097677851 12:62622374-62622396 GGTGCTGGTGCTGCTGCTCCTGG - Intergenic
1099072354 12:78061070-78061092 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
1099359872 12:81686980-81687002 GATGTTGCTGCTGCTGCTGGTGG - Intronic
1100665710 12:96750283-96750305 GCTGCTGCTGCTGCTGCTGCAGG - Intronic
1101331395 12:103760609-103760631 GATGATGGTGATGATACTGATGG + Intronic
1102278229 12:111598998-111599020 GCTGCTGCTGCTGCTGCTGCTGG + Exonic
1102371032 12:112382359-112382381 GAGGCGGATCCTGCTCCTGAGGG - Intronic
1103036561 12:117661741-117661763 GATGCTGCTGCTGCTGGTGATGG + Intronic
1103735549 12:123058620-123058642 GAGGCAGGTGCTGCTCTTGAGGG - Intronic
1104484336 12:129136973-129136995 GATGCTGATGATGCTGTTGATGG - Intronic
1104798927 12:131540059-131540081 GATGATGGTGATGATGCTGATGG + Intergenic
1104932963 12:132349774-132349796 GATGCTGATGGTGATGCTGATGG - Intergenic
1104987701 12:132606197-132606219 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1105420911 13:20251579-20251601 GCTGCTGCTGCTGCTGCTGCTGG + Intergenic
1105719549 13:23100436-23100458 GATGCTGCTGCTGCTGCTGATGG + Intergenic
1106108183 13:26752868-26752890 GATGCTGGTGCTGCTGGTGAGGG + Intergenic
1106383479 13:29262907-29262929 TCTGCTGGTGCTGGTACTGATGG + Intronic
1106393600 13:29359341-29359363 GCAGCTGGTGCTGCGGCTGAAGG + Exonic
1106686715 13:32067970-32067992 GATGCTGGTGCTGCTGCCCTGGG - Intronic
1106751935 13:32781664-32781686 GTTGCTGCTGCTGCTGCTGGGGG - Intergenic
1106793882 13:33184361-33184383 GCTGCTGCTGCTGCTGCTGATGG + Intronic
1107070767 13:36266262-36266284 GAGGTGGGTGCAGCTCCTGAGGG + Intronic
1107899258 13:44995832-44995854 GCTGCTGCTGCTGGTCCTGCTGG + Intronic
1108025966 13:46177853-46177875 GCTGCTGCTGCTGCTGCTGATGG + Intronic
1108257195 13:48622206-48622228 GATGTTACTGCTCCTCCTGAGGG + Intergenic
1108709142 13:53016030-53016052 TTTGCTGGTGCTGCTTCTGTGGG + Intergenic
1110648455 13:77916833-77916855 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1110873349 13:80479166-80479188 GATGCTGGTGCTGCTAGTCTAGG - Intergenic
1110881548 13:80578122-80578144 GCTGCTGCTGCTGCTGCTGTGGG - Intergenic
1111134811 13:84027444-84027466 GATGCTACTGCTGCTGCTAAAGG - Intergenic
1112450282 13:99501657-99501679 GCTGCTGTCGCTGCTCCTGCTGG + Exonic
1113440522 13:110324653-110324675 GATGGTGGTGCTGCTGCCCAGGG + Intronic
1113679707 13:112234706-112234728 GGTCCTGGTCCTGCTCCTGGGGG + Intergenic
1113774395 13:112934560-112934582 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1113930553 13:113966630-113966652 GATGATGATGATGCTGCTGATGG + Intergenic
1114631181 14:24160613-24160635 GGTGCTGGAGCTGTTCCTGAGGG - Exonic
1114673517 14:24427295-24427317 GGTGCTGGTTCAGCTTCTGACGG + Exonic
1114705315 14:24720417-24720439 GAAGCTGCTGATGCTTCTGAAGG - Intergenic
1114770492 14:25425265-25425287 GATTCTTATGCTGCTGCTGATGG - Intergenic
1115179382 14:30604584-30604606 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1116725269 14:48554774-48554796 GCTGCTGCTGCTGCTGCTGGGGG + Intergenic
1117062941 14:51981401-51981423 GATGCTGTTGCTGCCACTCAAGG + Intergenic
1117083651 14:52177619-52177641 GCTGCTGCTGCTGCTGCTGGTGG - Intergenic
1117083652 14:52177622-52177644 GGTGCTGCTGCTGCTGCTGCTGG - Intergenic
1117730230 14:58714824-58714846 GATGGAGGTGCTGCTCCTTAAGG + Intergenic
1117953904 14:61108157-61108179 GATGCGGGTGCTGCTCCTGCAGG - Intergenic
1119199721 14:72743366-72743388 GATCCTGGTGATGCTCCCTATGG - Intronic
1119874706 14:78048499-78048521 GCTGCTGTTGCTGCTGCTGGTGG + Intergenic
1120726010 14:87942249-87942271 GATGCTGATGCTGCTCGTCCAGG + Intronic
1120951926 14:90049589-90049611 GATCCTGGGGCTGCCCCTGATGG + Intergenic
1121104761 14:91272956-91272978 GGTGCTGGTGCTGCTGCTGCTGG - Exonic
1121210585 14:92205635-92205657 GATGCTGATGCTGATGCTGATGG - Intergenic
1121326523 14:93023347-93023369 GTTGCTGGTCCTGCACCAGAGGG - Intronic
1121511928 14:94519116-94519138 GGTGATGGTGCTGCTCGTGGTGG + Intergenic
1121512029 14:94519639-94519661 GATGGTGGTGGTGCTGGTGATGG + Intergenic
1121841245 14:97135956-97135978 GATGATGGTGGTGCTAATGATGG - Intergenic
1121841288 14:97136237-97136259 GATGCTGGTGGTGGTGGTGATGG - Intergenic
1121841299 14:97136288-97136310 GATGCTGGTGGTGGTGGTGATGG - Intergenic
1121874634 14:97440114-97440136 GCTGCTGCTACTGCTCCTGCTGG - Intergenic
1121963673 14:98284609-98284631 GATGCTGGTGGTGGTGGTGATGG + Intergenic
1122180682 14:99952247-99952269 GATGGTGGTGATGCTGATGATGG + Intergenic
1122180709 14:99952504-99952526 GATGATGGTGGTGATGCTGATGG + Intergenic
1122261635 14:100526702-100526724 GATGCTGATGGTGGTACTGATGG - Intronic
1122261644 14:100526789-100526811 GGTGCTGGTGCTGGTGATGATGG - Intronic
1122329411 14:100902601-100902623 GCTGCTGCTGCTGCTACTGCAGG - Intergenic
1122408619 14:101514681-101514703 GAGGATGGGGCTGCCCCTGAGGG - Intergenic
1123160532 14:106274577-106274599 GTTCCTGGTGCAGCTCCTGGAGG + Intergenic
1123185077 14:106508939-106508961 GTTCCTGGTGCAGCTCCTGGAGG + Intergenic
1123481569 15:20637613-20637635 GTTCCTGGTGCAGCTCCTGGAGG + Intergenic
1123636443 15:22362752-22362774 GTTCCTGGTGCAGCTCCTGGAGG - Intergenic
1123905633 15:24917685-24917707 GATGTTGGTGCTGCTCTTCAGGG + Intronic
1125480472 15:40075819-40075841 GAGGCATGTGCTGCTACTGAGGG + Intergenic
1125756730 15:42070008-42070030 TTGGCTGGTGCTGGTCCTGAGGG + Exonic
1126119132 15:45235667-45235689 GCTGCTCCTGCTGCTCCTGCTGG - Intergenic
1126223175 15:46239006-46239028 GATGCTGATGCTGATGCTGCTGG - Intergenic
1127404807 15:58631510-58631532 AATGCTGCTGCTGCTGCTGCTGG - Intronic
1127426691 15:58865179-58865201 GATGCTGGAGCTGCTGGTGCTGG + Intronic
1127472977 15:59307292-59307314 GGTGTTGGTGCAGCTGCTGAGGG - Intronic
1127884505 15:63187826-63187848 GCTGCTGCTGCTGCTGCTTACGG - Intergenic
1128015642 15:64342953-64342975 GACGCTGCTGCTGCTGCTGCTGG + Intronic
1128248497 15:66149059-66149081 GAGGCTGGAGGTGCTCCTGCCGG - Intronic
1130771804 15:86931595-86931617 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1131091861 15:89629540-89629562 GCTGCTGGTGCTGCTCCTCTCGG + Exonic
1131835692 15:96388435-96388457 GATGCTGTGGTTGGTCCTGAGGG + Intergenic
1132175735 15:99712504-99712526 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1132237984 15:100236357-100236379 GATGCTGGTGGTGCTGGTGTGGG - Intronic
1132499920 16:280716-280738 GCTGCTGGAGCTGCTCCGGCTGG + Exonic
1132513192 16:353923-353945 GGTGCTGGGGCTGCTGCTGGGGG - Intergenic
1133228450 16:4354699-4354721 GAGACTGGTGCTGCTCTAGAAGG + Exonic
1133288283 16:4701491-4701513 GCTGCTGCTGCTGCTCTGGACGG + Exonic
1133732862 16:8591045-8591067 GATGCTGCTGCTGGTGATGATGG - Intergenic
1133740559 16:8647980-8648002 GATGCTGCTGCTGCTCCAGCGGG - Exonic
1133784316 16:8963258-8963280 GCTGCTGCTGCTGCTGCTGGTGG + Exonic
1134751694 16:16630299-16630321 GATGCTGGTGCTGCTGGTCTGGG + Intergenic
1134863232 16:17579595-17579617 GATGCTGGTGCAGTTCCTCGGGG - Intergenic
1134993766 16:18723324-18723346 GATGCTGGTGCTGCTGGTCTGGG - Intergenic
1135195517 16:20390968-20390990 GATGATGGTGCTGGTGATGATGG - Intronic
1135856961 16:26020595-26020617 GATGCTGGTGCTGCTGCTCTGGG + Intronic
1136512787 16:30749090-30749112 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1136512788 16:30749093-30749115 GCTGCTGCTGCTGCTGCTGGTGG + Intronic
1136648907 16:31648643-31648665 GGTGCTGGGGCTGATGCTGATGG - Intergenic
1136776863 16:32876601-32876623 GCTGCTGCTGCTGCTGGTGAAGG - Intergenic
1136776864 16:32876607-32876629 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
1136779591 16:32887811-32887833 GTTCCTGGTGCAGCTCCTGGAGG - Intergenic
1136891027 16:33973707-33973729 GTTCCTGGTGCAGCTCCTGGAGG + Intergenic
1136893753 16:33984906-33984928 GCTGCTGCTGCTGCTGCTGCTGG + Intergenic
1136893754 16:33984912-33984934 GCTGCTGCTGCTGCTGGTGAAGG + Intergenic
1136911236 16:34146237-34146259 GCTGCTGTTGCTGCTGCTGCTGG + Intergenic
1136994154 16:35176728-35176750 GATATTGCTGCTGCTCCTGTGGG + Intergenic
1137769345 16:51003643-51003665 GATCCAGGTCCTGCCCCTGAGGG - Intergenic
1137916697 16:52439467-52439489 GATGCTGCTGCTGCTGCTGCAGG + Exonic
1138166656 16:54808122-54808144 GATGCTGCTGCTGCTGCTGCTGG + Intergenic
1138408193 16:56815877-56815899 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1139549326 16:67664810-67664832 GATGGTGGGGCTGATCCTGAGGG - Intronic
1139761398 16:69187244-69187266 GCTGGTGGAGCTGCTCCTGAGGG + Exonic
1140187609 16:72788666-72788688 GCTGCTGCTGCTGCTGCTGCTGG + Exonic
1140187612 16:72788669-72788691 GCTGCTGCTGCTGCTGCTGGGGG + Exonic
1140834858 16:78783934-78783956 GATGCTGGTGCTGTTGGTGATGG + Intronic
1141023150 16:80516929-80516951 AATGCGGGTCCTGCTCCTCAGGG - Intergenic
1141071139 16:80955337-80955359 GCTGCTGCTGCTGCTGCTGTTGG + Intergenic
1141090064 16:81124023-81124045 GATGCTGATGCTGCTGGTGTGGG - Intergenic
1141192480 16:81834595-81834617 GCTGCTGCTGCTGCTGCTGTTGG + Intronic
1141817138 16:86419272-86419294 GATGATGGTGGTGCTGGTGATGG + Intergenic
1141817212 16:86419752-86419774 GATGATGGTGCTGATGCTGATGG + Intergenic
1141881365 16:86861973-86861995 GATGCTGGTGGTGGTGGTGATGG + Intergenic
1141931827 16:87210260-87210282 GATGCTGGTGATGATGGTGATGG + Intronic
1141931862 16:87210509-87210531 GATGATGGTGCTGATGGTGATGG + Intronic
1142110943 16:88331063-88331085 GATGGTGGTGGTGGTCGTGATGG - Intergenic
1142208885 16:88798095-88798117 GATGATGGTGCTGATGGTGATGG + Intergenic
1142234484 16:88915367-88915389 GCTGCTTGTGGAGCTCCTGAAGG - Intronic
1203079279 16_KI270728v1_random:1138710-1138732 GCTGCTGCTGCTGCTGGTGAAGG - Intergenic
1203079280 16_KI270728v1_random:1138716-1138738 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
1203082007 16_KI270728v1_random:1149899-1149921 GTTCCTGGTGCAGCTCCTGGAGG - Intergenic
1142811179 17:2396314-2396336 CATGCTGGCGCTGCTGCTGGTGG - Intronic
1143164383 17:4890603-4890625 GCTGCTGTTGCTGCTGCTGCAGG - Exonic
1143296340 17:5874656-5874678 GACGCAGCTGCTGCTCCTGCTGG - Intronic
1143449041 17:7024697-7024719 GCTGCTGCTGCTGCTGCTGGAGG - Exonic
1143449042 17:7024700-7024722 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1143616955 17:8057505-8057527 GAAGGTGGTGATGCTGCTGAAGG + Intergenic
1143677546 17:8446747-8446769 GATGCTCTAGCTTCTCCTGAGGG - Exonic
1143894105 17:10123348-10123370 GATGCTGGTTCTGTTGCTGCTGG + Intronic
1143994586 17:10995754-10995776 GCTGCTGCTGCTGCTGCTGCTGG + Intergenic
1144141836 17:12356932-12356954 GAGGCTGGTTGTGCTCCAGATGG + Intergenic
1144180171 17:12744374-12744396 GTTGCTGCTGCTGCTGCTGCTGG - Exonic
1144671659 17:17136247-17136269 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1144777862 17:17793779-17793801 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1145898148 17:28472736-28472758 AATGCTGCTGCTGCTGCTGGTGG - Intronic
1146022930 17:29293972-29293994 GCTGCTGCTGCTGCTGCTGAGGG + Exonic
1146500742 17:33362338-33362360 GAGGGTGGTGCAGCTCTTGATGG + Intronic
1146806358 17:35868102-35868124 GATGCTGATGCTGCTGGTCATGG + Intronic
1147383028 17:40066751-40066773 GATGATGGTGATGATCATGACGG + Intronic
1147721401 17:42541825-42541847 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
1147881751 17:43658893-43658915 TCTGCTGCTGGTGCTCCTGAGGG + Intronic
1148189519 17:45668730-45668752 CTTGCTTGTCCTGCTCCTGAGGG - Intergenic
1148251517 17:46085158-46085180 GAAGCTGTTGCTGCTGCTGGAGG + Intronic
1148684818 17:49495462-49495484 GCTGCTGTTGCTGCTTCTGGGGG + Exonic
1148772536 17:50075714-50075736 GAAGCTGGAGCTGCTCCTGATGG + Exonic
1148847727 17:50538992-50539014 GGTGCTGCTGCTGCTGCTGGTGG + Intronic
1149071379 17:52547555-52547577 GATACTGGTGTTGCTCATCATGG - Intergenic
1149293469 17:55239059-55239081 GCTGCTGCTGCTGCTGCTGCTGG + Intergenic
1149293470 17:55239062-55239084 GCTGCTGCTGCTGCTGCTGGAGG + Intergenic
1149392620 17:56207193-56207215 GATGCTGATGCTGCTGTTCAGGG - Intronic
1149737733 17:59012215-59012237 GGTGGTGGTGCTGCTGCTGCTGG - Intronic
1150302187 17:64055861-64055883 GCTGCTGCTGCTGCTGCTGCAGG + Exonic
1151164042 17:72189070-72189092 GATGGTGGTGCTGGTGATGATGG + Intergenic
1151318571 17:73338743-73338765 GGTGCTGGTGCTGTTGGTGACGG + Exonic
1151559595 17:74863142-74863164 GATGCTGCTGCAGGACCTGAAGG - Exonic
1151929699 17:77224516-77224538 GAGGCCGGTGCAACTCCTGAAGG + Intergenic
1152057586 17:78042748-78042770 GATGCTGGTGGTGATCATGGTGG + Intronic
1152067783 17:78121113-78121135 GCTGCTGGTCCTGCCCCTGGTGG - Exonic
1152534134 17:80940781-80940803 GATGAAGCTGCTGCTCCTCAAGG + Intronic
1152698806 17:81809048-81809070 GCTGCTGTTGCTGCTGCTGCTGG + Exonic
1152742323 17:82023712-82023734 GAAGCTGGTGCAGCTGCTGCAGG - Exonic
1152880124 17:82809664-82809686 CAGGCTGGTGGTGCCCCTGACGG + Intronic
1153921733 18:9797362-9797384 GATGCTTCTGCTTCTCCTGCTGG + Intronic
1153940229 18:9970410-9970432 AAAGCTGGTGGTTCTCCTGAAGG + Intergenic
1154206013 18:12337643-12337665 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
1154347781 18:13557807-13557829 GATGATGGTGATGATCATGATGG - Intronic
1154937657 18:21077464-21077486 GCAGCTGGTGCTGCTCATAAAGG + Intronic
1155103623 18:22639219-22639241 GTTGCTGCTGCTGCTGTTGATGG - Intergenic
1155113288 18:22737498-22737520 GAAACTGGTCCTGCTCCTGGAGG - Intergenic
1155627330 18:27849740-27849762 GCTTCTGATGCTGCTCCTGTTGG - Intergenic
1155881120 18:31150076-31150098 GATGATGGAGCTGCTGCTGATGG - Intronic
1157197642 18:45632386-45632408 GATGCTGGTGGGACTGCTGATGG + Exonic
1157202147 18:45668385-45668407 GGTGCTGGTGGGGCTGCTGATGG + Exonic
1157342747 18:46794020-46794042 GATGCTAATGCTGCTCTTCAGGG - Intergenic
1157710433 18:49846350-49846372 GATGCTGATGCTGATGCTGCTGG + Intronic
1158404836 18:57151800-57151822 GATGCTGGTGCTGCTGCCCCAGG + Intergenic
1158613093 18:58961230-58961252 GATGCTGATGCTGCTCATCTTGG + Intronic
1158705280 18:59787026-59787048 GTTGCTGCTGCTGCTGCTGGTGG - Intergenic
1159402919 18:67960335-67960357 GCTGCTGCTGCTGCTGCTGATGG + Intergenic
1159542013 18:69790131-69790153 GTGCCTGGTGCTTCTCCTGATGG - Intronic
1159765977 18:72489035-72489057 GAAGCTGATACTGCTGCTGAGGG + Intergenic
1160057680 18:75499988-75500010 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
1160618840 18:80155621-80155643 GATGCTGATGCTGCTGGTGCAGG - Intronic
1160870482 19:1275573-1275595 GCCGCTGCTGCTGCTCCTGCTGG + Exonic
1161885922 19:6995555-6995577 GATGGTGGTGCTGATAGTGACGG + Intergenic
1161929823 19:7331428-7331450 GATGATGGTGGTGATCATGATGG - Intergenic
1162133934 19:8543968-8543990 GGTGCTGGTGCTGGTGCTGGTGG + Intronic
1162187355 19:8916250-8916272 GATGCTGGTGATACTGTTGATGG - Intronic
1162481107 19:10927692-10927714 GCTGCTGCTGCTGCTCCTGCAGG + Exonic
1162818036 19:13207879-13207901 GCTGCTGCTGCTGCTGCTGCGGG + Exonic
1162943456 19:14028216-14028238 CATGCTGCTGCTGCTCCTGGCGG + Exonic
1162955366 19:14094705-14094727 GCTGCTGCTGCTGCTGCTTAAGG + Intronic
1163313839 19:16529768-16529790 GTTGCTGCTGCTGCTGCTGCTGG + Exonic
1163668238 19:18612988-18613010 GCTGCTGCTGCTGCTGCTGTTGG + Exonic
1165101133 19:33439359-33439381 GGCTCTGGTGCTGCTCCTCAGGG - Intronic
1165324364 19:35105656-35105678 GATGCTGATGCTGGTGGTGATGG - Intergenic
1165575972 19:36818285-36818307 GCTGCTGCTGCTGCTGCTGCTGG + Exonic
1165758032 19:38305309-38305331 GCTGCTGCTGCTGCTGCTGGGGG - Exonic
1165860639 19:38907455-38907477 TGTGCTGGAGCTTCTCCTGAGGG + Exonic
1165861626 19:38912104-38912126 GCTGCTGCGGCTGCTCCTGCTGG - Exonic
1166118135 19:40667998-40668020 GTTGCTGCTGCTGCTGCTGCTGG + Exonic
1166853224 19:45770201-45770223 GCTGCTGCTGCTGCTGCTGGGGG - Exonic
1166853227 19:45770204-45770226 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1167023723 19:46898794-46898816 GCTGCTGCTGCTGCTGCTGTTGG + Intergenic
1167265696 19:48482087-48482109 GAGGCTGCTGCTGCTTCTGGGGG - Intronic
1167424529 19:49423270-49423292 GCTGCTGCTGCTGCTGCTGGTGG - Exonic
1167424530 19:49423273-49423295 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1167443684 19:49525055-49525077 GCTGCTGCTGCTGCTGCTGCGGG + Intronic
1167508765 19:49884706-49884728 GCGACTGCTGCTGCTCCTGAGGG + Exonic
1167696621 19:51019055-51019077 GAAGCTGCTGCCGCTGCTGATGG - Exonic
1168131208 19:54320534-54320556 GCTGCTGGTGCAGATCATGAGGG + Intergenic
1168144567 19:54413732-54413754 GATGCTGGTGATGGTGGTGATGG - Intergenic
1168177000 19:54633487-54633509 GATGCTGGCGATGCCACTGAGGG - Intronic
1168264869 19:55217180-55217202 GTGGCTGGTGCGGCTCCCGATGG + Intergenic
1168322677 19:55519208-55519230 GATGATGGTGATGATCGTGATGG + Intergenic
1168322700 19:55519398-55519420 GATGATGGTCCTGGTCATGAGGG + Intergenic
1168322713 19:55519498-55519520 GATGATGGTCCTGGTCATGAGGG + Intergenic
1168322742 19:55519703-55519725 GATGGTGGTGCTGGTCATGAGGG + Intergenic
1168429712 19:56268437-56268459 GATGCTGCTGCTGCTGCTGCTGG + Intronic
1168642214 19:58038064-58038086 GATGCTGGAGCTGCTGGTGCTGG + Exonic
1168650633 19:58089985-58090007 GATGCTGGAGCTGCTGGTGCTGG - Exonic
925191949 2:1892238-1892260 GCTGCTGGTGCTGCTGCTGCTGG + Exonic
925478021 2:4240388-4240410 GATGCTGGTGGTGCTGGTGGGGG + Intergenic
925548588 2:5044117-5044139 GATGCTGGAGCAGAGCCTGAAGG + Intergenic
925960495 2:9010133-9010155 GGTGCTGCTGCTGCTGATGAAGG - Intergenic
926311648 2:11679897-11679919 CAGGCTGGTGCTGCACCTGGAGG + Intronic
926670722 2:15574713-15574735 GAGGCTGGGGCTGCTGCTGGGGG - Intergenic
927083220 2:19650768-19650790 GATGCTGGGGCTCCTACTGTTGG - Intergenic
927185590 2:20479934-20479956 GCTGCTGCTGCTGCTGCTGCTGG + Intergenic
927256357 2:21043876-21043898 GCTGCTGCTGCTGCTGCTGGCGG - Exonic
927457036 2:23261782-23261804 GCTGCTGCTGCTGCTGCTGCTGG + Intergenic
927506994 2:23621176-23621198 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
928220608 2:29399965-29399987 GAGTCTGGTGCTGATCCTCATGG + Intronic
928947469 2:36784389-36784411 GATGCTGATGCTGATTCTGCTGG - Intronic
929231441 2:39564715-39564737 GGTGCTGCTGCTGCTGCTGCTGG + Intergenic
929231442 2:39564718-39564740 GCTGCTGCTGCTGCTGCTGGTGG + Intergenic
929261734 2:39873446-39873468 GCCGCTGCTGCTGCTCCTGCGGG + Intergenic
929752441 2:44729814-44729836 GATGCTGGTGGTGCTGGTCAGGG - Intronic
929779229 2:44947055-44947077 GGTGCTGGTGCTGCTGGGGATGG - Intergenic
929878804 2:45819109-45819131 GATGCTGCTGCTGATGCTGATGG + Intronic
930167080 2:48213640-48213662 TATGCTGGTGCAGCTTATGATGG - Intergenic
931909893 2:66887810-66887832 GCTGCTGCTGCTGCTACTGTTGG - Intergenic
932023608 2:68112696-68112718 GACCCTGGTGCTGATCCTTAGGG - Intergenic
932166736 2:69514629-69514651 GTTGCTGCTGCTGCTGCTGCTGG + Exonic
932453824 2:71833475-71833497 GATGATGGTGATGATCCTGCTGG - Intergenic
932493330 2:72134721-72134743 GGTGCTGGTGCTGCCCGTGAGGG + Intronic
933302801 2:80561626-80561648 GAAATTGGTGCTCCTCCTGAGGG + Intronic
934098247 2:88627211-88627233 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
934752564 2:96802937-96802959 GATGCTGGTGCTGCTCCTGATGG - Intronic
934832861 2:97549244-97549266 GATGCTGATGCTGATGCTGCTGG - Intronic
935397052 2:102619899-102619921 GCTGTTGCTGCTGCTCCTGCAGG + Exonic
935594862 2:104870474-104870496 GATGCTGCTGCTGCTGCTGTAGG + Intergenic
935623445 2:105148295-105148317 GCTCCTGGTGCTGCTGCTGCTGG - Intergenic
936403618 2:112184128-112184150 GGGGCTGGTTCTGCTCCTGCAGG + Intronic
936661342 2:114547310-114547332 GCTGCTGCTGCTGCCCCTGCAGG + Intronic
937022527 2:118671374-118671396 GCTGCTGTTGCTGCTGCTGCTGG + Intergenic
937303025 2:120854864-120854886 GATGCTGCTGCTGCTGCTGTTGG + Intronic
937321787 2:120965402-120965424 GATGCAGGTGCTGCAGCAGAGGG + Intronic
937321844 2:120965668-120965690 GATGCAGGTGCTGCGGCAGAGGG + Intronic
938076297 2:128340472-128340494 GATGATGGTGCTGGTGCTGGTGG + Intergenic
938076537 2:128341237-128341259 GATGGTGGTGCTGGTGCTGGTGG + Intergenic
938163278 2:129005315-129005337 GTTGCAGCTGCTGCTCCTAATGG - Intergenic
938458828 2:131484581-131484603 GCTGCTGCTGCTGCCGCTGATGG - Intronic
938964898 2:136379735-136379757 GATGCTGCTGCTGCTGCTCCAGG + Intergenic
939189825 2:138902745-138902767 CATGCTGGTGGCGCTCGTGATGG + Intergenic
939546701 2:143563696-143563718 GATGATGGTGATGATCATGATGG - Intronic
940561022 2:155297001-155297023 GTTGCTGGTGCTGCTGATGCAGG + Intergenic
940987288 2:160062361-160062383 GCTGCTGCTGCTGCTGCTGGGGG - Exonic
940987291 2:160062364-160062386 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
941264139 2:163338502-163338524 GCTGCTGCTGCTGCTGCTGCAGG - Intergenic
942139782 2:172966466-172966488 GCTGCTGCTGCTGCTCCTCCAGG + Intronic
942928189 2:181457714-181457736 GATGCTGTTGCTGTGCCTGGGGG + Exonic
942990072 2:182189954-182189976 AAGGCTGGTGTTGCTCATGAAGG - Intronic
943342180 2:186694299-186694321 GCTGCTGCTGCTGCTGCTGTTGG - Exonic
944402575 2:199345117-199345139 GGGGCTGGTGCTGCTGCTGCTGG + Intronic
945160721 2:206887589-206887611 GATGCAGGTGCTGCTGGTGTGGG - Intergenic
946401161 2:219469069-219469091 GATGCTGGGGCTGCCTGTGAGGG + Intronic
946456465 2:219830631-219830653 GGTGCTGATGCTGCTGCTCAGGG - Intergenic
946736006 2:222755231-222755253 GATGCTGATGCTGCTGCTCTAGG - Intergenic
947118685 2:226796681-226796703 GCTGCTGCTGCTGCTGCTGCTGG + Exonic
947722585 2:232378820-232378842 GCTGCTGCTGCTGCTGCTGCTGG + Exonic
947912912 2:233813272-233813294 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
947912913 2:233813278-233813300 GCTGCTGCTGCTGCTGGTGATGG + Intronic
948076552 2:235169325-235169347 GATGGTTGTGCTGATCATGATGG + Intergenic
948119164 2:235516073-235516095 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
948174700 2:235934102-235934124 GCTGCTGCTGCTGCTCCTGGAGG - Intronic
948436672 2:237958431-237958453 GATGCTGGAGCCGCTCTTGCAGG - Intergenic
948660420 2:239503283-239503305 TAGGCTGGTCCTGCTCTTGATGG - Intergenic
948740988 2:240045908-240045930 GAGGGAGGTGCTGCTCCAGACGG + Exonic
1168951324 20:1803843-1803865 GCTTCTCGTGCCGCTCCTGAGGG - Intergenic
1169241799 20:3987985-3988007 TAAGCTGCTGCTGCTGCTGAAGG - Intronic
1169270882 20:4198574-4198596 GATGCTGATGCTGCTGTTCAGGG - Intergenic
1169318139 20:4609838-4609860 GGTGCAGGAGCTGCTGCTGAGGG - Intergenic
1169975110 20:11316492-11316514 GATGCTGATGCTACTGGTGAGGG + Intergenic
1170839476 20:19912413-19912435 GATGCAGGGGCTTTTCCTGATGG - Intronic
1170993784 20:21331573-21331595 GATGCTAGTGCTCCTGGTGAAGG + Exonic
1172197274 20:33100525-33100547 GGTGCTGGTGCTGCTCATGGAGG + Intronic
1172555851 20:35840651-35840673 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
1172940638 20:38651589-38651611 GGTGATGGTGATGCTGCTGATGG + Intergenic
1172940641 20:38651622-38651644 GATGCTGCTGCTGATGATGATGG + Intergenic
1172940651 20:38651688-38651710 GATGATGGTGATGCTGCTGATGG + Intergenic
1172940658 20:38651760-38651782 GATGCTGCTGCTGCTGCTGGTGG + Intergenic
1172940663 20:38651811-38651833 GATGATGGTGATGCTGCTGACGG + Intergenic
1173158479 20:40634883-40634905 GATGCTGATGCTGCTTCTGTGGG - Intergenic
1174039278 20:47687506-47687528 GATGTTGGGGCTGCTGCTGATGG - Intronic
1174086410 20:48011254-48011276 GAAGTTGATGCTGCTGCTGATGG - Intergenic
1174548944 20:51347331-51347353 GATGCTGGTAGTGATGCTGATGG + Intergenic
1174967787 20:55238535-55238557 GATGGAGGTGCTGATCCTCAGGG + Intergenic
1175410733 20:58766492-58766514 AAAGCTGGTGCTGCCCGTGAGGG + Intergenic
1175547150 20:59785736-59785758 GATGCTGGTGCTGCTGACCACGG - Intronic
1175595070 20:60224460-60224482 AATGCTGCTGCTGCAGCTGATGG + Intergenic
1175746077 20:61458269-61458291 GATGCTGGTGGTGGTGGTGATGG + Intronic
1176145885 20:63565287-63565309 GGTGCTGGTGCAGCTCCTTTCGG - Exonic
1176171529 20:63698473-63698495 GCTGCTGGTGCGGCTGCTGCAGG + Exonic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1178165889 21:29976284-29976306 GCTGCTGTTGCTGCTAATGATGG + Intergenic
1180009503 21:45040320-45040342 CATGCTGCTGCTGCTGCTGTGGG + Intergenic
1180087995 21:45516648-45516670 AACGCTGGTGCTGCTCCTTCTGG - Intronic
1180193993 21:46182738-46182760 GAAGCAGGTGCGCCTCCTGAAGG - Exonic
1180706514 22:17813628-17813650 GATGTTAGTGCTGTTCCTTAGGG - Intronic
1180984978 22:19898781-19898803 CAGGCTGGGGCTGCTCTTGAGGG + Intronic
1181104307 22:20564628-20564650 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1181182856 22:21079471-21079493 CATGTTGCTTCTGCTCCTGACGG - Intergenic
1181509156 22:23381294-23381316 GATGCCGGTGCTGGTGGTGATGG + Intergenic
1181532607 22:23525492-23525514 GATGGTGGTGGTGATGCTGATGG + Intergenic
1181961063 22:26622129-26622151 GAAGCAGGTGCTGGTCTTGATGG - Intronic
1182123101 22:27799481-27799503 GCTGCGGGGGCTGCTGCTGAGGG + Exonic
1182123131 22:27799613-27799635 CATGCTGCTGCTGCTGCTGCTGG + Exonic
1182788061 22:32924483-32924505 GATGCTGCTGATGCTGCTGTTGG - Intronic
1183742828 22:39678162-39678184 GATGCTGGTCCTGCTGCTCAGGG + Intronic
1183850888 22:40586896-40586918 GCTGCTGGTGCTGCTGGTGCTGG + Intronic
1184080263 22:42214357-42214379 GCTGCTGCTGCTGCCCCTGTTGG + Exonic
1184314188 22:43670863-43670885 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
1184519674 22:44985873-44985895 GGTGGTGGTGCTGCTGGTGATGG - Intronic
1184519730 22:44986257-44986279 CATGATGGTGCTGCTGGTGATGG - Intronic
1184519747 22:44986379-44986401 GATGGTGGTGCTCCTGGTGATGG - Intronic
1185136194 22:49074286-49074308 GATGATGGTGCTGCTGCTGATGG - Intergenic
1185200511 22:49500905-49500927 GATGGTGGTGATGGTCATGATGG - Intronic
1185247249 22:49779759-49779781 GATGGAGTCGCTGCTCCTGAGGG - Intronic
1185320215 22:50197261-50197283 GATGCAGATGCTGCTGCTGAAGG + Exonic
949268635 3:2188716-2188738 GATGCTGGTGCTGGGCCTTGGGG + Intronic
949644152 3:6073924-6073946 GATGATGGAGCAGCTCCTGTGGG + Intergenic
949923829 3:9024972-9024994 GGTGCTGGTGCTGGTGCTGGTGG + Intronic
950405761 3:12803572-12803594 GATGCTGCTCCGGCTCCTGGAGG + Exonic
950604244 3:14064355-14064377 GCTGCTGGGGCTGCTGCTGCTGG - Exonic
950604250 3:14064382-14064404 GCTGCTGGGGCTGCTGCTGCTGG - Exonic
950604312 3:14064796-14064818 GGTGCTGGAGCTGCTGCTGCTGG - Exonic
950604318 3:14064841-14064863 GCTGCTGGGGCTGCTGCTGCTGG - Exonic
950837391 3:15933849-15933871 GATGCTGATGCTGCTGATCAGGG - Intergenic
950981795 3:17315050-17315072 GATACTGATGCTGCTCGTGTGGG + Intronic
951429566 3:22590407-22590429 GATGCTGGTGCTTATCATGTGGG - Intergenic
951529181 3:23682754-23682776 GCTGCTGTTGCTGCTGCTGCTGG + Intergenic
951641675 3:24843657-24843679 GATGCTGATGCTGCTCATCGGGG - Intergenic
951995198 3:28719745-28719767 GCTGCTGCTGCTGCTGCTGCTGG + Intergenic
952742357 3:36746920-36746942 GATGCTGATGCTGATGCTGTTGG + Intergenic
952852604 3:37741287-37741309 GCTGCTGTTGCTGCTGCTGGGGG - Intronic
953389221 3:42525010-42525032 GATGCTGCTGATGCTGCTCATGG + Intronic
953627136 3:44580469-44580491 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
953627137 3:44580472-44580494 GCTGCTGCTGCTGCTGCTGGTGG + Intronic
953657025 3:44862131-44862153 GCTGTTGGTGCTGCTGCTGCGGG + Intronic
953748905 3:45595047-45595069 GCTGCTGCTGCTGCTGCTGGAGG - Exonic
954303571 3:49713976-49713998 GATCCTGGTGCGGCTCTGGAGGG + Exonic
954747927 3:52797488-52797510 CTTGCTGGTGTTGCTCTTGAGGG - Intronic
955333791 3:58068769-58068791 GCTGCTGCTGCTGCTGCTGTAGG + Intronic
955916492 3:63912682-63912704 GCTGCTGCTGCTGCTGCTGCCGG - Exonic
956465619 3:69517997-69518019 GATGCTGCTGCTGCTGCTGCTGG + Intronic
956707653 3:72013111-72013133 GAAGCTGGTAGGGCTCCTGAAGG - Intergenic
956787060 3:72651624-72651646 GATGGTGGAGATGCTGCTGATGG - Intergenic
957337986 3:78857568-78857590 GATGCTGATGCTGATGCTGCTGG - Intronic
957741506 3:84276093-84276115 TATGCTGGTGCTGTTCTTAAAGG - Intergenic
958002696 3:87771673-87771695 GGTGCAAGTGCTGGTCCTGATGG + Intergenic
958185910 3:90118680-90118702 GATGCTGTTTCTTATCCTGAAGG - Intergenic
958967044 3:100570647-100570669 GATGCTGGCACTGATCTTGAAGG - Intronic
959128811 3:102325383-102325405 GCTGCTGCTGCTGCTCTTCAGGG + Intronic
959291087 3:104475134-104475156 CATGCTGCTGCTGCTGCTGCTGG + Intergenic
960536973 3:118825534-118825556 GATGCTGGTGCTGCTTGTCTGGG - Intergenic
960548154 3:118941956-118941978 GATGCTGGAGCTGGGACTGAGGG + Intronic
960874673 3:122284771-122284793 GCTGCTGCTGCTGCTCTTGCTGG - Exonic
961166075 3:124764808-124764830 GATGTGGGTGCTGCCCATGAGGG - Intronic
961218154 3:125177794-125177816 GCTGCTGTTGCTGTTCCTGCTGG - Exonic
961241063 3:125412064-125412086 AATGTTAGTGCTGCTCCTCAGGG - Intergenic
961534855 3:127564077-127564099 GCTGCTGGTGGTGCTGCTGGTGG - Intergenic
961656511 3:128445423-128445445 GGTGGTGCTGCTGCTACTGATGG + Intergenic
961827452 3:129606519-129606541 GCTGTTGCTGCTGCTCCTGGGGG - Exonic
961924104 3:130458414-130458436 GATGCTGATGCTGCTTGTGTAGG - Intronic
962067229 3:131994422-131994444 GATGGTGCAGCTGCTCCTGCTGG - Intronic
962146385 3:132844283-132844305 GATGCTGAAGCTGCTTCTGGGGG - Intergenic
962775245 3:138652933-138652955 GATGCTGATGCTCCTCATCAGGG + Exonic
962942674 3:140140132-140140154 GATGCTGATGCTGATGCTGATGG + Intronic
963024215 3:140902215-140902237 GAAGCTGCTGCTGCTCCTAAAGG + Intergenic
963117022 3:141738676-141738698 GCTCCTGCTGCGGCTCCTGAGGG + Intronic
963313842 3:143737846-143737868 GCTGCTGCTGCTGTTGCTGATGG - Intronic
964421548 3:156509386-156509408 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
964714923 3:159711950-159711972 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
964720550 3:159764480-159764502 GCTGCTGCTGCTGCTGCTGCCGG - Exonic
966840434 3:184083176-184083198 GAGGCTGGGCCTGCACCTGATGG - Intergenic
967073793 3:185984095-185984117 GATGCTGGTGCTCCTGCTGCTGG + Intergenic
967328448 3:188266172-188266194 GCTGCTGCTGCTGCTGGTGAGGG - Intronic
967990924 3:195130206-195130228 CATGCTGGGGCTGTACCTGAGGG - Intronic
968589828 4:1451834-1451856 GATGGTGGTGGTGCTCGTGATGG - Intergenic
968592890 4:1468087-1468109 AATGGTGATGCTGCTGCTGATGG + Intergenic
968592891 4:1468093-1468115 GATGCTGCTGCTGATGGTGATGG + Intergenic
968602047 4:1514141-1514163 GATGCTGGTGGTGATGATGATGG + Intergenic
968763802 4:2457787-2457809 GAGGCTGGTGCTGTGGCTGATGG + Intronic
968785156 4:2616222-2616244 GATGCTGATGCTGATGATGATGG - Intronic
968850557 4:3074876-3074898 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
968961590 4:3747841-3747863 GATGCTGGTGATGTTTCTGATGG - Intergenic
969134474 4:5019400-5019422 CGTGCTGCTGCTGCTCCTGGCGG - Exonic
969208774 4:5670298-5670320 GATGGTGATGCTGCTGCTGATGG - Intronic
969234662 4:5857210-5857232 GATGATGGTGGTGCTGGTGATGG - Intronic
969281053 4:6170928-6170950 GATGCTGGTGGTGGTGGTGATGG - Intronic
969281097 4:6171129-6171151 GATGATGGTGGTGCTGGTGATGG - Intronic
969336063 4:6511275-6511297 GATGCTGATGCTGATGCTGATGG + Intronic
969336253 4:6512064-6512086 GATGGTGGTGATGGTGCTGATGG + Intronic
969336278 4:6512160-6512182 GATGGTGGTGATGGTGCTGATGG + Intronic
969336327 4:6512340-6512362 GATGGTGGTGATGGTGCTGATGG + Intronic
969336400 4:6512634-6512656 GATGGTGGTGATGGTGCTGATGG + Intronic
969347577 4:6579090-6579112 GATGGTGGTGGTGCTGGTGATGG - Intronic
969347599 4:6579183-6579205 GATGGTGGTGGTGCTGGTGATGG - Intronic
969636562 4:8372859-8372881 GGTGCTGGTGCTGCTGCGGTGGG - Intronic
969860811 4:10034014-10034036 GGTGCTGGGGGTGCTGCTGAGGG - Intronic
970551983 4:17190829-17190851 GATGCTGCAGGTGCTGCTGATGG - Intergenic
971448894 4:26781072-26781094 GATGCTGATGCTGCTTCCCAGGG - Intergenic
972335549 4:38104560-38104582 GTTGCAGCTGCTGCTGCTGAAGG + Intronic
972827529 4:42777771-42777793 GATGGGGGTACTGCTTCTGAAGG + Intergenic
972887188 4:43507219-43507241 GATGCTGTTGCTGTTGATGAGGG + Intergenic
973605100 4:52579065-52579087 GCTGCTGGTGCTGCTGGTGCTGG + Intergenic
975409993 4:74038533-74038555 GCTGCTGCTCCTGCTCCTGGTGG - Exonic
975415381 4:74099042-74099064 GCTGCTGCTCCTGCTCCTGGTGG - Exonic
975878392 4:78870928-78870950 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
976009430 4:80469113-80469135 GATGCTGATGCTGCTGATTAAGG - Intronic
976961362 4:90980157-90980179 GTTGCTAGTGCAGCTCCTAAGGG - Intronic
977178265 4:93840882-93840904 GATGCCTGCGCTGCTCCTGCAGG - Intergenic
977710837 4:100123059-100123081 GGTGCTGCTGCTGCTGATGATGG - Intergenic
978143685 4:105347322-105347344 GATGCTGATGATGCTGCTGATGG - Intergenic
979036132 4:115720762-115720784 GAACCTGGTGGAGCTCCTGAAGG + Intergenic
979489463 4:121308638-121308660 GCTGCTTGTGCTGCCTCTGAAGG - Intergenic
979632205 4:122916111-122916133 GCTGCTGCTGCTGCTGCTGGTGG - Intronic
981080301 4:140633427-140633449 GAGGCTGGGCCTGCTCCTGCTGG + Intronic
981420035 4:144538906-144538928 GATGGTGGTGATGGTGCTGATGG - Intergenic
981511964 4:145567037-145567059 GCTGCTGCTGCTGCTGCTGCTGG + Intergenic
983091498 4:163508353-163508375 AATGCTGGTGCTGTTGCTGCTGG + Intronic
984405845 4:179328819-179328841 GGTGCTAGAGCTGCTCCTGCAGG + Intergenic
985093822 4:186392083-186392105 GCTGCTGCTGCTGCTGCTGCAGG - Intergenic
985279453 4:188270841-188270863 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
985279456 4:188270865-188270887 GCTGCTGCTGCTGCTGCTGGTGG - Intergenic
985279457 4:188270868-188270890 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
985279460 4:188270892-188270914 GCTGCTGGTGCTGGTGCTGGTGG - Intergenic
985279466 4:188270925-188270947 GGTGCTGGTGCTGCTGCTGGTGG - Intergenic
985396881 4:189553554-189553576 GTTGCTGCTGCGGCTGCTGAAGG - Intergenic
985494900 5:198957-198979 GTAGCTGGGGCTGCTCCTGGCGG + Exonic
985978844 5:3445893-3445915 GATGCTGGTGATGGTGGTGATGG + Intergenic
985978899 5:3446199-3446221 GATGGTGGTGATGGTGCTGATGG + Intergenic
986400179 5:7372135-7372157 GATGGTGGTGCTGATGGTGATGG - Intergenic
986456733 5:7927471-7927493 GCTGTTGGTGCTGCTACTGTAGG - Intergenic
986736341 5:10670350-10670372 GATGATGGTGCTGGTGATGATGG + Intergenic
987156917 5:15097729-15097751 GATGATGGTGATGATGCTGATGG + Intergenic
987241826 5:16007739-16007761 TTTACTGGTGCTGGTCCTGAGGG - Intergenic
987364449 5:17136477-17136499 GATGCTTGTGTTTCTCCTGATGG + Intronic
989207378 5:38824488-38824510 GGTGCTGGTGCTGGTGCTGGTGG - Intergenic
989716323 5:44467844-44467866 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
991930280 5:71747504-71747526 GCTGCTGCTGCTGCTTCTGAAGG + Intergenic
993363415 5:87005412-87005434 GATGATGATGAGGCTCCTGATGG + Intergenic
993486232 5:88489623-88489645 GCTGCTGCTGCTGCTGCTGCAGG + Intergenic
995053197 5:107730065-107730087 AATGCTGATGCTGCTCATCAGGG + Intergenic
995696689 5:114885804-114885826 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
996990244 5:129621601-129621623 GCTGCTGATGCAGCTACTGATGG - Intronic
997243052 5:132322302-132322324 GATGCTGCTGCTGGCGCTGACGG + Exonic
997283851 5:132664752-132664774 GGTGCTGGTGCTGGTCCAGCCGG - Intergenic
998903428 5:146878740-146878762 GCTGCTGCTGCTGCTGCTGCAGG + Intronic
999142720 5:149373119-149373141 GATGCTGGTGCTGCTGGTCTGGG - Intronic
999970856 5:156861018-156861040 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
1000215590 5:159152710-159152732 GGTGCTGGTGCTGTTGCTGGTGG - Intergenic
1000352746 5:160365007-160365029 GATGTAGTTGCTGCTCCTGTAGG + Intronic
1000907404 5:166979191-166979213 GCTGCTGCTGCTGCTGCTGGTGG - Intergenic
1000907405 5:166979194-166979216 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
1001083307 5:168682518-168682540 GATGCTGGTGCTGCTGCCTTGGG + Intronic
1001234132 5:170015160-170015182 GCTGTTGCTGCTGCTGCTGATGG - Intronic
1001482649 5:172099215-172099237 GCTGCTGCTCCTGCTGCTGACGG - Intronic
1001700075 5:173700478-173700500 GATGCTGGTGCTGCTGGTCCCGG + Intergenic
1001858751 5:175034808-175034830 GATGATGCTGCTGCTGCTGCTGG + Intergenic
1001858752 5:175034811-175034833 GATGCTGCTGCTGCTGCTGGTGG + Intergenic
1002054725 5:176592190-176592212 GATGATGGTGCTGATGGTGATGG + Intronic
1002198941 5:177516306-177516328 GGTGCTGGTGCTGATCCAGGAGG + Exonic
1002579295 5:180197961-180197983 GATGCTGGTGTGGGTCCGGAAGG + Intronic
1003143361 6:3489888-3489910 GATGCTGATGCTGGTGCTGCTGG - Intergenic
1003398109 6:5770409-5770431 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1003398112 6:5770412-5770434 GCTGCTGCTGCTGCTGCTGGGGG + Intronic
1005835003 6:29702331-29702353 GTTCCTGCTGCTGCTCCTGCAGG - Intergenic
1005959522 6:30685724-30685746 GCTGCTGCTGCCGCTCCTGCCGG + Exonic
1006154236 6:32005706-32005728 GCTGCTGCTGCTGCCCCTGCTGG + Intergenic
1006155161 6:32009790-32009812 GAAGATGGTGCTGGTCCTGGAGG + Intergenic
1006160540 6:32038440-32038462 GCTGCTGCTGCTGCCCCTGCTGG + Exonic
1006161467 6:32042524-32042546 GAAGATGGTGCTGGTCCTGGAGG + Exonic
1006860740 6:37170245-37170267 GCTGCTGCTGCTGCTGCTGCCGG - Exonic
1006894676 6:37459897-37459919 GATCTTGGTGTTGCTCCTGGTGG + Intronic
1007168779 6:39847660-39847682 GATGCTGGTGGTGCCACGGAGGG - Intronic
1007576682 6:42929627-42929649 GCTGCTGCTGCTGCTGCTGCCGG + Exonic
1007844618 6:44742898-44742920 GCTGCTGGTTCTACTCATGAGGG + Intergenic
1008283767 6:49625616-49625638 GATGCTGCTGCTGCTGATGGTGG - Intronic
1008283768 6:49625619-49625641 GAGGATGCTGCTGCTGCTGATGG - Intronic
1008716393 6:54295093-54295115 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
1010003500 6:70971387-70971409 GATGCTGATGCTGCTAGTCAGGG + Intergenic
1011164540 6:84431491-84431513 GATGTGGGTCCTGCTCTTGAGGG + Intergenic
1011282635 6:85691766-85691788 CCTGATGCTGCTGCTCCTGATGG + Intergenic
1011626165 6:89285522-89285544 GATGGTGATGCTGCTCTGGAGGG - Intronic
1012247163 6:96938628-96938650 GCTGCTGCTGCTGCTGCTGCAGG - Intronic
1012400053 6:98835242-98835264 GCTGCTGATGCTGCTGCTGCAGG - Exonic
1012954452 6:105553740-105553762 GATGATGGTACTGACCCTGAAGG - Intergenic
1012976838 6:105789066-105789088 GCTGCTGCTGCTGCTGATGATGG - Intergenic
1013014261 6:106146673-106146695 GATGCTGATGCTGATGCTGATGG + Intergenic
1013068333 6:106705023-106705045 GATGCTGATGCTGATGCTTAAGG - Intergenic
1015799329 6:137044659-137044681 GCTGCTGCTGTTGCTCCTGGCGG - Exonic
1016926384 6:149353227-149353249 GGTGCTGCTGCTGCTGCTGCTGG + Intronic
1017233217 6:152094503-152094525 GCCGCTGGTGCTGCTGCTGCAGG - Exonic
1017672126 6:156778268-156778290 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1017911181 6:158794303-158794325 GGTGCTGGTGCTGGTGCTGGTGG - Intronic
1018041912 6:159932186-159932208 GATGCTGGTGCTGCCTGTGCTGG - Intergenic
1018110759 6:160534949-160534971 GATGGTGGTGCTGGTGATGATGG + Intronic
1018818732 6:167356253-167356275 CACCCAGGTGCTGCTCCTGAAGG - Intronic
1018981572 6:168605739-168605761 GATACAGGTACTGATCCTGAAGG + Intronic
1019180395 6:170183799-170183821 GATGGTGGTGATGGTGCTGATGG + Intergenic
1019310059 7:355833-355855 GATGCTGGTGATGGTGGTGATGG - Intergenic
1019778960 7:2928672-2928694 GATGCTGCTGCGGCTCCGGGGGG + Exonic
1019805411 7:3120189-3120211 GATGATGGTGGTGATCATGACGG - Intergenic
1021131142 7:16913980-16914002 ACTGCTGCTGCTGCTACTGAGGG + Intergenic
1021155817 7:17208354-17208376 GCTTCTGTTGCTGATCCTGAAGG + Intergenic
1021966971 7:25929512-25929534 GATGCTGTGGCAGCTTCTGACGG + Intergenic
1022956139 7:35382157-35382179 GATTCTGGTGATGCCCCAGAGGG - Intergenic
1023353067 7:39339688-39339710 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1023882569 7:44328605-44328627 GGTGATGGTGGTGCTGCTGATGG + Intronic
1023882570 7:44328608-44328630 GATGGTGGTGCTGCTGATGGTGG + Intronic
1024230933 7:47362795-47362817 GATGATGGTGATGATGCTGATGG - Intronic
1024230988 7:47363338-47363360 AATAGTGGTGCTGCTGCTGATGG - Intronic
1024598674 7:50961330-50961352 GATGCTGATGCTGCTCATCCAGG + Intergenic
1024675963 7:51638174-51638196 GACTCTGGAGCTGCTGCTGAGGG + Intergenic
1025943730 7:66091143-66091165 GATGCTGGTGCTGCTAGTTGGGG - Intronic
1025992443 7:66506083-66506105 CAAGCTGCTGCTGCTCCTCACGG - Intergenic
1026113229 7:67475014-67475036 GATGATGGTGGTGGTGCTGATGG + Intergenic
1026479596 7:70766217-70766239 GGTGCTGGTGCTGGTGCTGATGG - Exonic
1026913635 7:74107003-74107025 GATGCTGCAGCTCCTCCTGGGGG - Exonic
1026992406 7:74594599-74594621 TATGCTGCTGCTGCTGCTGGGGG - Intronic
1027462015 7:78466165-78466187 GATGCTGGAGTTGTTCCTAAGGG - Intronic
1028125776 7:87111457-87111479 GATGCTGATGCTGCTGGTGTGGG - Intergenic
1028458958 7:91070250-91070272 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1028458959 7:91070253-91070275 GCTGCTGCTGCTGCTGCTGGTGG + Intronic
1028709420 7:93890627-93890649 GATTCTGCTGCTTTTCCTGACGG - Exonic
1029098397 7:98107204-98107226 GAGGCTGCTGCTGCTGCTGCTGG + Exonic
1029189354 7:98760830-98760852 GCTGCTGGTGCCCCTGCTGAGGG + Intergenic
1029371851 7:100155357-100155379 GCTGCTGGGGCTGCTCTTGCGGG + Exonic
1029506482 7:100966482-100966504 GCTGCTGGTGCTGCTGCTGCTGG + Exonic
1030861171 7:114631524-114631546 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1032125380 7:129189199-129189221 GCTGCTGCTGCTGCTGCTGCTGG + Exonic
1032125383 7:129189202-129189224 GCTGCTGCTGCTGCTGCTGGGGG + Exonic
1032257853 7:130311394-130311416 GATGCCAGGCCTGCTCCTGATGG - Intronic
1032731419 7:134646901-134646923 GCTGCTGCTGCTGCTGCTGCTGG + Exonic
1032731420 7:134646904-134646926 GCTGCTGCTGCTGCTGCTGGTGG + Exonic
1032848623 7:135773198-135773220 GATGCTGGTGCTGCTGGTTCAGG - Intergenic
1033177849 7:139142079-139142101 GATGCTGTTTCTGCTACTGCAGG + Intronic
1034286099 7:149884004-149884026 GAGGGAGGTGCTGCTCCTGCTGG + Intergenic
1034679114 7:152915057-152915079 GATGATGGTGCTGGTGCTGAAGG - Intergenic
1034713901 7:153221527-153221549 GATGCTGGAGCCCCTCCAGATGG + Intergenic
1034731178 7:153388782-153388804 GGTGCTGCTGCTGCTCCTGGTGG - Intergenic
1034849109 7:154477260-154477282 GGTGCTGGTGCTGCTGGTGGTGG - Intronic
1034908118 7:154968958-154968980 GGTGCTGCTGCTGCTGCTGCTGG + Exonic
1034953644 7:155318294-155318316 GATGGTGGTGATGATCATGATGG - Intergenic
1035297612 7:157876059-157876081 GCTGCAGGTGCTGCCCCAGATGG - Intronic
1035326806 7:158070916-158070938 GGTGCTGGAGGTGCTCCTGGTGG + Intronic
1035326948 7:158071534-158071556 GATGATGGAGGTGCTCCTGGTGG + Intronic
1035340165 7:158155424-158155446 GGTGATGGTGGTGCTACTGATGG - Intronic
1035448199 7:158957306-158957328 GCTGCTGGGGCTGCTCCTGTGGG + Intergenic
1035860817 8:3026233-3026255 GATGTTATTGCTGCTGCTGATGG - Intronic
1036090295 8:5657834-5657856 GATGCTGGAGCTGTCCCTCATGG + Intergenic
1036422129 8:8606885-8606907 GCTGCTGCTGCTGCTGCTGCTGG + Intergenic
1036579064 8:10055491-10055513 GATGCTGCTGCTGCTGCGGCAGG - Intronic
1036592761 8:10183810-10183832 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1036592762 8:10183813-10183835 GCTGCTGCTGCTGCTGCTGGTGG + Intronic
1036592781 8:10183930-10183952 GGTGGTGGTGCTGCTGCTGGTGG + Intronic
1036704315 8:11035264-11035286 GATGCTGGCGGTGATCCCGATGG - Intronic
1036800332 8:11786274-11786296 GGAGCTGGTGGTGCTCCTCACGG + Exonic
1037124901 8:15335889-15335911 GATGATGGTGCTGCCTGTGATGG - Intergenic
1038297835 8:26312397-26312419 GATGCTGGTGTTGCTGCTGGTGG + Intronic
1039231785 8:35456379-35456401 GATGCTGATGCTGCTGATTAAGG + Intronic
1039258031 8:35740431-35740453 GAGGCTTGTGCTCCTTCTGAAGG - Intronic
1039583172 8:38683362-38683384 GCTGAATGTGCTGCTCCTGATGG - Intergenic
1039922107 8:41900579-41900601 GATGATGGTGATGCTGGTGATGG - Intergenic
1040419034 8:47221994-47222016 GATGGTGATGATGCTCATGATGG - Intergenic
1041594319 8:59629367-59629389 TGTTCTGGAGCTGCTCCTGATGG + Intergenic
1041789161 8:61672571-61672593 TATGCTGGTGTGGGTCCTGAAGG - Intronic
1042095961 8:65216327-65216349 GGTGCTGCTGCTGCTCCTCTGGG - Intergenic
1042346814 8:67736027-67736049 GATGCTGGTGATCCCTCTGAAGG + Intronic
1042689452 8:71481736-71481758 GCTGCTGTTGCTGCTGCTGCTGG - Intronic
1045585029 8:103524882-103524904 AATACTGATGCTGCTCCTGCAGG + Intronic
1046098008 8:109583089-109583111 GTTGCTGCTGCTGCTGCTGGTGG - Intronic
1047532112 8:125686168-125686190 GTTGCTGCTGCTGCTGCTGGTGG - Intergenic
1047807262 8:128373450-128373472 GGTGCTGGTGCTGCTGCTGCTGG + Intergenic
1047807293 8:128373702-128373724 GTTGCTGGTGCTGCTGGTGCTGG + Intergenic
1048138343 8:131768330-131768352 GAAGCTGGTGCTCCACCTGCAGG - Intergenic
1048274466 8:133055824-133055846 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
1048752627 8:137697375-137697397 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
1048842656 8:138579092-138579114 GATGCTAGGGCAGCTCCTGAAGG + Intergenic
1048859660 8:138714674-138714696 TTTGATTGTGCTGCTCCTGATGG + Intronic
1049275008 8:141715935-141715957 AACGCTGGTGCTGCTCCCCAGGG - Intergenic
1049303490 8:141884324-141884346 GATGGAGCTGCTGCTACTGACGG + Intergenic
1049707411 8:144049293-144049315 GCTGCTGCTGCTGCTGCTGGTGG + Intergenic
1049923772 9:389592-389614 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
1050604609 9:7287882-7287904 CATCCTGTTACTGCTCCTGAGGG + Intergenic
1051253343 9:15185496-15185518 GATGCTGCTGCTGCTGCTGGTGG - Intronic
1051424307 9:16918291-16918313 GATGATGATGCTGCTCCTCAGGG - Intergenic
1051757147 9:20414381-20414403 GCTGCTGCTGCTGCTGCTGCTGG + Exonic
1052716017 9:32118431-32118453 GATGATGGTGTGGCTCCTTAGGG - Intergenic
1053149781 9:35736107-35736129 GATGCAGGTGCTGCTGCTGCTGG - Exonic
1053180406 9:35963102-35963124 GCTGCTGCTGCTGCTGCTGTTGG - Intergenic
1053351457 9:37416097-37416119 GCTGCTGGTGGTGCTGCTGCTGG - Intergenic
1053542845 9:38993151-38993173 ACTGCTGCTGCTGCTGCTGAAGG - Intergenic
1053807291 9:41816668-41816690 ACTGCTGCTGCTGCTGCTGAAGG - Intergenic
1054623301 9:67370759-67370781 ACTGCTGCTGCTGCTGCTGAAGG + Intergenic
1055056021 9:72024989-72025011 GATGCTGCTGCTGCTGCTGCTGG - Intergenic
1055443390 9:76358592-76358614 GATGCTGGTGCTTCTGCTCGGGG + Exonic
1055735502 9:79325034-79325056 GATACTGCTGCTGCTACTGGTGG + Intergenic
1056255274 9:84792977-84792999 GATGATGGTGATGATACTGATGG - Intronic
1056660465 9:88539358-88539380 GATACTGCTGCTGCTGCTGCTGG + Intronic
1056717031 9:89040129-89040151 GGTGGTGATGCTGCTGCTGATGG - Intronic
1056717037 9:89040189-89040211 GATGGTGATGATGCTGCTGATGG - Intronic
1056717047 9:89040258-89040280 GATGATGGTGCTGCTGCTGATGG - Intronic
1058071929 9:100610087-100610109 AATGCTGGTGCAGGTCCTGGAGG + Intergenic
1058276906 9:103054574-103054596 GATATTGGGGCTGCTCATGAGGG - Intergenic
1058866622 9:109167075-109167097 GCTGCTCCTGCTGCTACTGACGG - Exonic
1058872804 9:109217018-109217040 GATGCTGATGCTGGTGCTGGTGG + Exonic
1059395986 9:114034433-114034455 GCTGCTGCTGCTGCTGCTGTTGG + Intronic
1059436256 9:114278330-114278352 GATGGTGGTGCTGGTGCTGGTGG + Intronic
1059450637 9:114369674-114369696 GATGCTGATGGTGATGCTGATGG - Intronic
1059506730 9:114806010-114806032 CATGCTCCTGCTGCTCCTGGAGG + Exonic
1059780703 9:117523291-117523313 ACTGCTGGTGCTGCTGGTGAAGG + Intergenic
1060752946 9:126186105-126186127 GATGATGGAGAGGCTCCTGAAGG + Intergenic
1061208524 9:129177665-129177687 GGTGCTGGTGCAGCTGCTGCTGG + Exonic
1061208567 9:129177857-129177879 GCTGCTGTTGCTGCTGCTGCTGG + Exonic
1061247849 9:129410258-129410280 GATGGTGGTGGTGATGCTGATGG - Intergenic
1061247863 9:129410351-129410373 GATGGTGGTGGTGATGCTGATGG - Intergenic
1061247880 9:129410435-129410457 GATGTTGGTGGTGATGCTGATGG - Intergenic
1061247905 9:129410576-129410598 GATGGTGGTGGTGATGCTGATGG - Intergenic
1061433114 9:130543649-130543671 GCTGCTGCTGCTGCTGCTGCAGG + Intergenic
1061492749 9:130955371-130955393 GATGATGGTGATGGTGCTGATGG - Intergenic
1061888360 9:133604758-133604780 GATGCTGCTGCTGCTGCTGCTGG + Intergenic
1062084626 9:134642253-134642275 GCTGCTGCTGCTGCTGCTGTGGG + Exonic
1062383907 9:136300963-136300985 AGCGCTGGTGCAGCTCCTGATGG - Intronic
1062405483 9:136394329-136394351 GATGCTGTGGCTTCTCCTCAGGG - Exonic
1062458932 9:136654825-136654847 GATGATGGTGATGCTGATGATGG - Intergenic
1062467393 9:136687306-136687328 GCTGCTGTTGCTGCTGCTGCTGG - Exonic
1185721193 X:2382903-2382925 GCTGCTGCTGCTGCTAATGATGG - Intronic
1185721206 X:2383065-2383087 GATGCTGCTGCTGCTGATGATGG - Intronic
1186214553 X:7284933-7284955 GATGGTGGTGATGCTGATGATGG + Intronic
1187265794 X:17731926-17731948 GCTGCTGCTGCTACTGCTGAGGG - Exonic
1187472949 X:19585690-19585712 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
1187617543 X:21013943-21013965 GATGCTGATGCTGATGCTGCTGG + Intergenic
1187629460 X:21152848-21152870 GATGCTGATGCTGCTGCTCTTGG + Intergenic
1188071353 X:25721761-25721783 GCTGCTGCTGCTGCTTCTGCAGG + Intergenic
1188443820 X:30236272-30236294 TATGTTGGTGCAGTTCCTGATGG + Exonic
1189083069 X:37994721-37994743 GATGGTGGTGCTGGTGGTGATGG + Intronic
1189102978 X:38210245-38210267 GATGCTGCTGCTGTTGCTGCTGG + Intronic
1189197925 X:39167353-39167375 GCTGCTGCTGCTGCTGCTCAGGG + Intergenic
1189198207 X:39169274-39169296 GATGCTGATGCTGCTTCTCAGGG - Intergenic
1189277741 X:39798992-39799014 GATGCTGATGCTGCTCTTCCAGG + Intergenic
1190443198 X:50496201-50496223 GATGCTGCTGCTGCTTCTGCTGG - Intergenic
1190503253 X:51099828-51099850 GATGCAGCTGCTGTTCCTCATGG + Intergenic
1190643759 X:52505754-52505776 GTTGCTGCTGCTGCTGCTGCTGG - Intergenic
1191081749 X:56519054-56519076 GCTGCTGCTGCTGCTGCTGGTGG - Intergenic
1191081750 X:56519057-56519079 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
1191720581 X:64225250-64225272 GAAGCTGGTGCCTCTCCTGGTGG - Exonic
1191895997 X:65994080-65994102 GAGGCTAGGGCTGCTCCAGAGGG + Intergenic
1192102665 X:68280764-68280786 TCTGCTGGTGCTGGTCATGATGG + Intronic
1192457676 X:71290706-71290728 GCTGGTGGTGCTGCTGCTGGTGG - Exonic
1192457677 X:71290709-71290731 GCTGCTGGTGGTGCTGCTGCTGG - Exonic
1194977292 X:100408561-100408583 GCTGCCGGTGCTGCTGCTGCTGG - Exonic
1195528548 X:105923280-105923302 GATGCCAGTGCTGATACTGATGG + Exonic
1198707612 X:139465684-139465706 GCTGCTGCTGCTTCTCCTGCTGG - Intergenic
1201560437 Y:15310455-15310477 GATGGTGGTGATGGTGCTGAAGG + Intergenic
1202095172 Y:21242331-21242353 GATGCTGGAGCTGCTCAACATGG - Intergenic