ID: 934752874

View in Genome Browser
Species Human (GRCh38)
Location 2:96805227-96805249
Sequence TGGTATTCCCATGCAAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934752874_934752875 -4 Left 934752874 2:96805227-96805249 CCTGTTCTTGCATGGGAATACCA 0: 1
1: 0
2: 0
3: 8
4: 88
Right 934752875 2:96805246-96805268 ACCACAACCTCATCATAGAATGG 0: 1
1: 0
2: 0
3: 5
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934752874 Original CRISPR TGGTATTCCCATGCAAGAAC AGG (reversed) Intronic
901529963 1:9846663-9846685 TGGTATTCACCTGCAGGGACAGG + Intergenic
902741365 1:18440899-18440921 TGGTTTTCCCAGGAAGGAACGGG - Intergenic
902988466 1:20170210-20170232 TGGTTTTCCCATCCATGAAATGG - Intronic
908780115 1:67683101-67683123 TGGTATGTCCATGCTTGAACTGG - Intergenic
912310102 1:108611660-108611682 TTCACTTCCCATGCAAGAACTGG - Intronic
912693996 1:111827122-111827144 TAGTTTTCCCATCCAAAAACTGG - Intronic
916908248 1:169313410-169313432 TTGTATTGCCATTCAAGACCTGG - Intronic
919199904 1:194342857-194342879 TGGTACACCAATGCAAGTACCGG + Intergenic
921052545 1:211521331-211521353 AGGGTTTCCCATGCAAGAATAGG - Intergenic
921445024 1:215235714-215235736 TGGTATTCAAATGGGAGAACTGG - Exonic
1065478951 10:26172750-26172772 TGGTATCCCCAGGCTAGTACAGG - Intronic
1087078841 11:94150747-94150769 GGGTATTCCCAGGCCAGAAATGG - Intronic
1088950756 11:114567400-114567422 TGGTTTTCCCAGGCTAGAGCGGG - Intergenic
1090291135 11:125545907-125545929 TGGTAACCCCATGCAAGTTCTGG + Intergenic
1103828599 12:123761548-123761570 AGATATTCCCATCAAAGAACAGG - Exonic
1104347952 12:128019728-128019750 TAGTATTCCTTTGCATGAACAGG - Intergenic
1105874930 13:24542635-24542657 TAGTCTTCCTATTCAAGAACAGG - Intergenic
1111775963 13:92662330-92662352 TGCTACTTCCATGCTAGAACAGG + Intronic
1116741165 14:48756272-48756294 TGGTATTTCCATAAAAGAATTGG + Intergenic
1118366376 14:65101046-65101068 TGGTATTCTAATGCAAAAATTGG - Intronic
1129106808 15:73315406-73315428 GTGTATTCCCATGGATGAACAGG - Intergenic
1132081845 15:98872736-98872758 GGCTGTGCCCATGCAAGAACAGG - Intronic
1135667479 16:24347974-24347996 TGCTAATCCCATGCAAGAAACGG - Intronic
1138582718 16:57952105-57952127 TGCTATGCCCAGGCAGGAACTGG - Intronic
1142910656 17:3088118-3088140 TGGTGTTCCCAAGGAAGAAGAGG - Intergenic
1143129137 17:4665100-4665122 TGCTTTTCCCCTGAAAGAACCGG - Intergenic
1144278227 17:13698126-13698148 TGGTGTTCCCAAGAAAGAAGAGG - Intergenic
1148820174 17:50355518-50355540 TGGCATTCCTATCCAAGAACCGG + Exonic
1151771769 17:76167559-76167581 TGGTATTACCAGGTAAGATCAGG - Intronic
1151771784 17:76167640-76167662 TGGTATTGCCAGGTAAGATCAGG - Exonic
1153810892 18:8750608-8750630 TGGTAACCCCAAGGAAGAACTGG - Intronic
1154982658 18:21516359-21516381 AGGTATCCCTATGCAAAAACAGG - Intronic
1156800997 18:41113727-41113749 CCTTATTGCCATGCAAGAACTGG - Intergenic
1163777268 19:19225779-19225801 TGGTATGCCCATGCCAGGACTGG - Intronic
1164500819 19:28818608-28818630 TGGTCTGACCATGCAAGCACAGG + Intergenic
1164889120 19:31807904-31807926 TCATTTTCCCATGCAGGAACAGG - Intergenic
927058672 2:19392130-19392152 TGGTGATCCCATGCATGAAGGGG + Intergenic
928782934 2:34847452-34847474 TGGTATTCCCGAGGAAGAAGAGG - Intergenic
929056673 2:37883981-37884003 TGGTATTTCCATGCAAGGAAGGG + Intergenic
934752874 2:96805227-96805249 TGGTATTCCCATGCAAGAACAGG - Intronic
940235280 2:151504852-151504874 TGAAATTCCCATGACAGAACAGG + Intronic
948887353 2:240890915-240890937 TGGTTTTCCCCTGCAAGGAAAGG - Intronic
1168994454 20:2122508-2122530 TGGGATTCCCCTGAAAGAAGTGG + Intronic
1169317544 20:4605568-4605590 GAGTTTTCCCATCCAAGAACAGG + Intergenic
1169952533 20:11061460-11061482 TAGTATTCCCAGGCATTAACTGG - Intergenic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1172945932 20:38689207-38689229 TGGTAGTCTCCTACAAGAACAGG + Intergenic
1175285881 20:57836454-57836476 TGGTTTTACCATGCTAGACCAGG - Intergenic
1178972834 21:37196015-37196037 TGGTATTCCCATGTTACAACAGG + Exonic
1179149892 21:38800864-38800886 AGGTATTTCCTTGCTAGAACTGG + Intergenic
1183783822 22:40017633-40017655 TGGTATCCCCATGCCACAGCCGG - Intronic
951362179 3:21738366-21738388 TGGTCTTCCCATTTAAAAACAGG + Intronic
952156961 3:30653907-30653929 TGGTTTTCTCATGCATAAACAGG - Intronic
953670517 3:44958448-44958470 TGCTTTTCCCATACAAGAAAAGG + Intronic
956234597 3:67054588-67054610 TAGTATTCCAATGCAAGGTCTGG - Intergenic
960200995 3:114836405-114836427 TGGTTTTCCAAAGCAAGAACTGG + Intronic
963002097 3:140691554-140691576 TGCTATTCCCAGGCAAGGATGGG + Intronic
965660792 3:171039952-171039974 TGGTTTTACCATCCAAGACCAGG + Intergenic
971233647 4:24821286-24821308 TGCCATTTCCATGCATGAACGGG - Intronic
974031629 4:56781541-56781563 TCCTATACCTATGCAAGAACAGG + Intergenic
975196553 4:71531340-71531362 TGGCAGTCACATGCAAGAAGTGG + Intronic
975905044 4:79199892-79199914 TGGTATTCCTATTATAGAACTGG + Intergenic
975947557 4:79725981-79726003 TGATATTCCCATGAAATATCAGG + Intergenic
977277481 4:94995742-94995764 TGGTATTTCCAGGCAAGCACAGG + Intronic
981868877 4:149462272-149462294 TGGTTTGCCAATGCAAGAAGAGG + Intergenic
981904731 4:149909402-149909424 TGGTATTCTCATCAAAGAAACGG + Intergenic
982215244 4:153077088-153077110 TGCTATCCCCAGGCAAGAAAGGG + Intergenic
984446276 4:179840836-179840858 TGGTGTTCCCATGGAAGAGGAGG - Intergenic
985425339 4:189824963-189824985 TGTTATTTACATGGAAGAACTGG + Intergenic
988911040 5:35844472-35844494 TGGATTTCCCATAAAAGAACAGG - Intergenic
990884859 5:60579715-60579737 TGGTTTGCCCATGCCAGAGCTGG - Intergenic
993402234 5:87467814-87467836 TGGCATTCTCATCAAAGAACAGG + Intergenic
995181281 5:109233046-109233068 TGGTATTCCATTGTAAGAATAGG - Intergenic
996925292 5:128818806-128818828 TGGTATTCACATGCAAAAGAAGG + Intronic
999844215 5:155460642-155460664 AGGTAACCCCATGAAAGAACTGG - Intergenic
1007782369 6:44261972-44261994 TAGTATTTCCTTGGAAGAACAGG - Intronic
1010267773 6:73886294-73886316 TTGTGTTCCCATGCAAAAAGAGG - Intergenic
1010857611 6:80861092-80861114 TGCTTTTCCCTTTCAAGAACAGG + Intergenic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1013053100 6:106556167-106556189 TGGATTTCACATGTAAGAACAGG + Intronic
1016427605 6:143950952-143950974 TGGTATTCCCATCAAAGGAGAGG + Intronic
1025088674 7:56044235-56044257 AAATATTCCCATGCAAGACCAGG - Intronic
1033362189 7:140645505-140645527 TGGTTTTCCCATCCATGAAATGG + Intronic
1033662082 7:143408985-143409007 TGGTAATCAAATTCAAGAACCGG + Intergenic
1034145316 7:148865916-148865938 TGGTACTTCCTTGAAAGAACTGG - Intronic
1042039763 8:64578891-64578913 TGATATTACCATTCAAAAACAGG + Intergenic
1043936477 8:86148414-86148436 TGGAAATCCTATGTAAGAACAGG - Intronic
1044372786 8:91433046-91433068 TGGCATTGCCATGAAAGAAAAGG + Intergenic
1046732328 8:117738878-117738900 TGGTGCTCACATGCAGGAACAGG + Intergenic
1048907433 8:139101917-139101939 TTGTATTCCCATACTAGAACAGG - Intergenic
1052371200 9:27666394-27666416 AGGTATTCCCATACACAAACTGG + Intergenic
1060776760 9:126380298-126380320 GGATATTCCCATGAAAGACCAGG - Intronic
1186910801 X:14162792-14162814 TGTTATCAACATGCAAGAACAGG - Intergenic
1187161290 X:16767779-16767801 TGTGGTTCCCATGCAAGAATGGG - Intergenic
1190618537 X:52262695-52262717 TGATATTCCCCTGAAAAAACAGG + Intergenic
1192047275 X:67689084-67689106 TGGTTTTCCCATCATAGAACTGG + Intronic
1193120243 X:77815752-77815774 TCATATTTCTATGCAAGAACAGG + Intergenic