ID: 934754414

View in Genome Browser
Species Human (GRCh38)
Location 2:96815890-96815912
Sequence GGAAGTTCCCGGCTTGGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 162}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934754414_934754432 23 Left 934754414 2:96815890-96815912 CCGCTCCCAAGCCGGGAACTTCC 0: 1
1: 0
2: 0
3: 10
4: 162
Right 934754432 2:96815936-96815958 GCGCGGGGGACAGCATCGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 68
934754414_934754431 20 Left 934754414 2:96815890-96815912 CCGCTCCCAAGCCGGGAACTTCC 0: 1
1: 0
2: 0
3: 10
4: 162
Right 934754431 2:96815933-96815955 CGGGCGCGGGGGACAGCATCGGG 0: 1
1: 0
2: 0
3: 13
4: 119
934754414_934754434 29 Left 934754414 2:96815890-96815912 CCGCTCCCAAGCCGGGAACTTCC 0: 1
1: 0
2: 0
3: 10
4: 162
Right 934754434 2:96815942-96815964 GGGACAGCATCGGGAGGAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 224
934754414_934754426 8 Left 934754414 2:96815890-96815912 CCGCTCCCAAGCCGGGAACTTCC 0: 1
1: 0
2: 0
3: 10
4: 162
Right 934754426 2:96815921-96815943 TGGCTCGGCCTCCGGGCGCGGGG 0: 1
1: 0
2: 1
3: 13
4: 127
934754414_934754423 1 Left 934754414 2:96815890-96815912 CCGCTCCCAAGCCGGGAACTTCC 0: 1
1: 0
2: 0
3: 10
4: 162
Right 934754423 2:96815914-96815936 AGAGAATTGGCTCGGCCTCCGGG 0: 1
1: 0
2: 0
3: 4
4: 91
934754414_934754433 28 Left 934754414 2:96815890-96815912 CCGCTCCCAAGCCGGGAACTTCC 0: 1
1: 0
2: 0
3: 10
4: 162
Right 934754433 2:96815941-96815963 GGGGACAGCATCGGGAGGAGTGG 0: 1
1: 0
2: 0
3: 26
4: 417
934754414_934754422 0 Left 934754414 2:96815890-96815912 CCGCTCCCAAGCCGGGAACTTCC 0: 1
1: 0
2: 0
3: 10
4: 162
Right 934754422 2:96815913-96815935 CAGAGAATTGGCTCGGCCTCCGG 0: 1
1: 0
2: 0
3: 12
4: 92
934754414_934754419 -7 Left 934754414 2:96815890-96815912 CCGCTCCCAAGCCGGGAACTTCC 0: 1
1: 0
2: 0
3: 10
4: 162
Right 934754419 2:96815906-96815928 AACTTCCCAGAGAATTGGCTCGG 0: 1
1: 0
2: 2
3: 15
4: 174
934754414_934754424 6 Left 934754414 2:96815890-96815912 CCGCTCCCAAGCCGGGAACTTCC 0: 1
1: 0
2: 0
3: 10
4: 162
Right 934754424 2:96815919-96815941 ATTGGCTCGGCCTCCGGGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 51
934754414_934754427 9 Left 934754414 2:96815890-96815912 CCGCTCCCAAGCCGGGAACTTCC 0: 1
1: 0
2: 0
3: 10
4: 162
Right 934754427 2:96815922-96815944 GGCTCGGCCTCCGGGCGCGGGGG 0: 1
1: 0
2: 6
3: 37
4: 277
934754414_934754425 7 Left 934754414 2:96815890-96815912 CCGCTCCCAAGCCGGGAACTTCC 0: 1
1: 0
2: 0
3: 10
4: 162
Right 934754425 2:96815920-96815942 TTGGCTCGGCCTCCGGGCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 122
934754414_934754430 19 Left 934754414 2:96815890-96815912 CCGCTCCCAAGCCGGGAACTTCC 0: 1
1: 0
2: 0
3: 10
4: 162
Right 934754430 2:96815932-96815954 CCGGGCGCGGGGGACAGCATCGG 0: 1
1: 0
2: 1
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934754414 Original CRISPR GGAAGTTCCCGGCTTGGGAG CGG (reversed) Intergenic
900349461 1:2227872-2227894 GGAAGAGCCCGGCTGGGGAGCGG + Intergenic
902729832 1:18362167-18362189 TGAAGTTCTGGGCTTGGTAGCGG - Exonic
902798248 1:18813762-18813784 TGGAGTTCCCGGCTGGTGAGCGG + Intergenic
903006975 1:20305252-20305274 TGAAGTTCAAGGCATGGGAGTGG + Intronic
904370436 1:30044576-30044598 GGAAGTTCTGGGGCTGGGAGTGG + Intergenic
904475283 1:30760910-30760932 GGAAGTTCACGACTTGGCTGGGG - Intergenic
906079026 1:43071471-43071493 GGAAGTTGCTGGTTTGGGTGAGG + Intergenic
907046990 1:51305470-51305492 GGAGTTTCCCAGCTGGGGAGGGG - Intronic
910892870 1:92035800-92035822 AAAAGTACCTGGCTTGGGAGGGG - Intronic
912345213 1:108957369-108957391 GGGAATTCCCTGGTTGGGAGAGG - Intronic
912763062 1:112386165-112386187 AGAAGCTCCGGGCCTGGGAGTGG - Intergenic
913050579 1:115113699-115113721 GGAAGACCTGGGCTTGGGAGAGG + Intergenic
914883297 1:151564515-151564537 GGCAGTTCCTGGCCTGGGAGGGG - Exonic
917099580 1:171431757-171431779 CGAAGTTCCAGGCTTGAGGGTGG + Intergenic
917690512 1:177463493-177463515 GTAATCTCCTGGCTTGGGAGTGG - Intergenic
920175846 1:204101300-204101322 GGAAGTGCCCACTTTGGGAGTGG + Intronic
920920724 1:210295241-210295263 GGAAGTCCCCGGCTGGGCTGGGG + Intergenic
921180389 1:212627042-212627064 GGATTTTCCAGGGTTGGGAGGGG - Intergenic
923391033 1:233514976-233514998 GGAGGCTCCGGGCCTGGGAGTGG - Intergenic
924087278 1:240465595-240465617 GGAATCTCCCAGCATGGGAGAGG - Intronic
1071215746 10:83399046-83399068 GGAAGTGCGGGACTTGGGAGAGG - Intergenic
1074589227 10:114796922-114796944 GAAAGTTCACGGTTTGGGATGGG - Intergenic
1077012348 11:384918-384940 GGGGGTTCCAGGCCTGGGAGTGG - Intergenic
1077012362 11:384956-384978 GGGGGTTCCAGGCCTGGGAGTGG - Intergenic
1077012376 11:384994-385016 GGGGGTTCCAGGCCTGGGAGTGG - Intergenic
1077012390 11:385032-385054 GGGGGTTCCAGGCCTGGGAGTGG - Intergenic
1077012404 11:385070-385092 GGGGGTTCCAGGCCTGGGAGTGG - Intergenic
1077012418 11:385108-385130 GGGGGTTCCAGGCCTGGGAGTGG - Intergenic
1077012432 11:385146-385168 GGGGGTTCCAGGCCTGGGAGTGG - Intergenic
1077012446 11:385184-385206 GGGGGTTCCAGGCCTGGGAGTGG - Intergenic
1077012460 11:385222-385244 GGGGGTTCCAGGCCTGGGAGTGG - Intergenic
1077012474 11:385260-385282 GGGGGTTCCAGGCCTGGGAGTGG - Intergenic
1077012488 11:385298-385320 GGGGGTTCCAGGCCTGGGAGTGG - Intergenic
1077012502 11:385336-385358 GGGGGTTCCAGGCCTGGGAGTGG - Intergenic
1077012516 11:385374-385396 GGGGGTTCCAGGCCTGGGAGTGG - Intergenic
1077012530 11:385412-385434 GGGGGTTCCAGGCCTGGGAGTGG - Intergenic
1077012544 11:385450-385472 GGGGGTTCCAGGCCTGGGAGTGG - Intergenic
1077012558 11:385488-385510 GGGGGTTCCAGGCCTGGGAGTGG - Intergenic
1077012572 11:385526-385548 GGGGGTTCCAGGCCTGGGAGTGG - Intergenic
1077012586 11:385564-385586 GGGGGTTCCAGGCCTGGGAGTGG - Intergenic
1077012600 11:385602-385624 GGGGGTTCCAGGCCTGGGAGTGG - Intergenic
1077012614 11:385640-385662 GGGGGTTCCAGGCCTGGGAGTGG - Intergenic
1077012628 11:385678-385700 GGGGGTTCCAGGCCTGGGAGTGG - Intergenic
1078011842 11:7578429-7578451 GGAAGTGTCCAGCTTGGAAGGGG + Intronic
1078505044 11:11932171-11932193 GCAAGTTCCGGGGTTGGGGGAGG + Intronic
1078720608 11:13880373-13880395 GGAAGTTGGCAGCTTGGGAGGGG - Intergenic
1083652087 11:64209618-64209640 GGAAGGGCCCAGCCTGGGAGGGG + Intronic
1085254866 11:75166749-75166771 GGGAGCTCCCAGCCTGGGAGAGG + Intronic
1089190625 11:116650791-116650813 GGGAGTGGCCTGCTTGGGAGAGG - Intergenic
1090288329 11:125519543-125519565 GGAGGTTCCAGGCTTAAGAGTGG + Intergenic
1092173249 12:6386097-6386119 GGAAGTGCCCGGCCTTGCAGGGG - Exonic
1093907802 12:24713124-24713146 GGGTGTTCCAGGCTTTGGAGAGG + Intergenic
1096750030 12:53752615-53752637 GAAAGCTCCAGGCTAGGGAGAGG - Intergenic
1100699658 12:97133729-97133751 GGAAGATTAGGGCTTGGGAGTGG - Intergenic
1101723982 12:107374418-107374440 GGAGGGTCCCAGCCTGGGAGGGG - Intronic
1102644716 12:114396507-114396529 GGACGTTCCCAGCTGGGGAGAGG - Intronic
1102896635 12:116603568-116603590 GGAATTTCCCGGCCTAAGAGGGG - Intergenic
1104613206 12:130246832-130246854 GGAAGTTCTCGGCTTGATGGGGG - Intergenic
1110003662 13:70238331-70238353 GCAAGTTTCCGGCTTGAGGGTGG - Intergenic
1112382578 13:98906203-98906225 TGGAGTTCCAGCCTTGGGAGTGG + Intronic
1112508294 13:99988604-99988626 GGAAGATCACAGCCTGGGAGTGG + Intergenic
1113799781 13:113080383-113080405 GGCAGTTCCTGGGTTGTGAGAGG + Intronic
1120405552 14:84090540-84090562 GGAAGATCCGGGCCTGGGAGTGG - Intergenic
1120853207 14:89189300-89189322 GGAAGTCCCTGCCTTTGGAGTGG - Intronic
1122356426 14:101125728-101125750 GGAGGTTCCCGTCTAGGGGGTGG + Intergenic
1125398307 15:39273410-39273432 AGAATTTCCCGGCATGAGAGAGG - Intergenic
1126263840 15:46729152-46729174 GGAATGTCCCTGCCTGGGAGTGG + Intergenic
1126523548 15:49623561-49623583 GGAAGTTCCAAGCTTGGGAAGGG - Intronic
1126701593 15:51372744-51372766 AGAAGTTCCAGGCCTGGGACCGG + Intronic
1129252310 15:74315792-74315814 GGAAGTGGCTGGCGTGGGAGTGG + Intronic
1130879843 15:88045540-88045562 GGAAGTTCACAGCTTTGGAGAGG - Intronic
1131305177 15:91236497-91236519 GGAAGTTGCAGAGTTGGGAGTGG + Intronic
1131719886 15:95156466-95156488 GGAATTTCCTTGCTTGGGATTGG - Intergenic
1132462833 16:63839-63861 TGAAGTCCCCTGCCTGGGAGGGG - Intronic
1132605463 16:792030-792052 GGATGTTCCCGTCTTGAGGGTGG + Intronic
1133808719 16:9144953-9144975 TGAGGTTCCAGGCTTGAGAGTGG - Intergenic
1135253803 16:20924027-20924049 CGAAGTCCCCGGCCTCGGAGTGG - Exonic
1136154730 16:28374985-28375007 GAAAGGGCCCGGCTTGGGGGTGG + Intergenic
1136208362 16:28740273-28740295 GAAAGGGCCCGGCTTGGGGGTGG - Intergenic
1137024199 16:35456829-35456851 GGAACTTCCTGTCTTAGGAGGGG - Intergenic
1137609905 16:49811249-49811271 TGAGGCTCCCGGCATGGGAGGGG + Intronic
1139504233 16:67391163-67391185 GGATGTTCTGGGCTTGGGGGAGG - Exonic
1141222375 16:82083174-82083196 GGAAGTTCCAGGAGTGGGATGGG + Intronic
1141385578 16:83619907-83619929 GGAAGACCCCGGCCTGGGAAGGG + Intronic
1141555715 16:84835470-84835492 GGAGGGTCCCTGCTTGGGAGGGG - Intronic
1141683900 16:85559294-85559316 GCAATTGCCCAGCTTGGGAGTGG + Intergenic
1141920104 16:87129969-87129991 GCAAGTCCCCGGCTGAGGAGGGG + Intronic
1142231831 16:88903646-88903668 GGGTGTTCCCGGCTGGGGGGGGG + Intronic
1142252867 16:89000729-89000751 GGAAGCCCCGGGCATGGGAGAGG - Intergenic
1142637411 17:1266741-1266763 GGAGGTTCCTGGCTTGGCCGTGG - Intergenic
1145795247 17:27651702-27651724 GGAAGGCCCCAGCTTGAGAGAGG + Intergenic
1147962637 17:44177352-44177374 GGCTGTCCCCAGCTTGGGAGGGG + Intronic
1151232798 17:72696664-72696686 GGAAGTTCCCTGGTGGGGTGTGG - Intronic
1154002182 18:10491290-10491312 GGAAGCTCTCTGCTTGTGAGTGG - Intergenic
1161041739 19:2114066-2114088 GGGAGTTCACGGCAAGGGAGGGG + Intronic
1163548251 19:17951702-17951724 GGAAGGTCCCAGCTAGGAAGGGG - Intronic
1165285647 19:34839382-34839404 GGAAGTGCCAGGTGTGGGAGAGG + Intergenic
1166882797 19:45939642-45939664 GTCAGTTCCGGGCTGGGGAGGGG + Exonic
1167089000 19:47330436-47330458 GGAAGCCCCCTCCTTGGGAGAGG - Intergenic
1167368256 19:49065649-49065671 GGAATTTCCTGGCTGGGGACCGG + Intergenic
1167445574 19:49535128-49535150 GAAACGTCCCGGCTGGGGAGTGG - Intronic
1167875152 19:52406047-52406069 GGCAGATCCCGGCTTCTGAGGGG - Intronic
1167932503 19:52877608-52877630 TGAGGTTCCCGGTTTGGGAGGGG + Exonic
928177718 2:29046405-29046427 GGAAGGTCCCATCTAGGGAGGGG + Intronic
933973328 2:87488018-87488040 GGAAGTTCACAGTTTGGAAGGGG + Intergenic
934754414 2:96815890-96815912 GGAAGTTCCCGGCTTGGGAGCGG - Intergenic
936320394 2:111462192-111462214 GGAAGTTCACAGTTTGGAAGGGG - Intergenic
937915123 2:127095218-127095240 GGATGTTAGTGGCTTGGGAGGGG - Intronic
945729620 2:213517867-213517889 GGAAGTTCCCTTCTTGAGATGGG + Intronic
948050688 2:234977259-234977281 GGAAGTTCCCGGCCAGGAAATGG - Intronic
948468907 2:238165064-238165086 GAAAGTTCCCGGGTGAGGAGTGG - Intronic
1172119486 20:32589415-32589437 GGAAGTTCCAGGCCTGGGGTGGG + Intronic
1172223380 20:33288660-33288682 GGGAGCTCCAGGCTGGGGAGGGG - Intronic
1172273252 20:33666486-33666508 GGAAGTTCCTGGTTGTGGAGAGG - Exonic
1172357145 20:34288111-34288133 GTCAGTTCCCGGCTAGGCAGAGG - Intronic
1174208485 20:48858233-48858255 GGAAGTTCCAGGGTTGACAGAGG - Intergenic
1175722463 20:61295577-61295599 GGAAGTTGCAGACTTGCGAGTGG + Intronic
1176311879 21:5154873-5154895 AGAAGGCCCCGCCTTGGGAGGGG - Intergenic
1179622633 21:42627354-42627376 GCCAGGTCCAGGCTTGGGAGAGG + Intergenic
1180082610 21:45493678-45493700 GGTAGAGCCCTGCTTGGGAGAGG - Intronic
1181160589 22:20957551-20957573 GGAGGATCCCAGCTTGGGATGGG + Intergenic
1185277619 22:49956670-49956692 AGCTGTTCCCAGCTTGGGAGGGG - Intergenic
953202627 3:40790989-40791011 GGGAGTTCCTGGCTAGGGATAGG + Intergenic
955670316 3:61394904-61394926 GGGAGGTCCAGGCTTGGGAAGGG - Intergenic
962479745 3:135788048-135788070 GGAAGTACCTGAATTGGGAGGGG - Intergenic
969818533 4:9703976-9703998 GGGAGTTAGGGGCTTGGGAGGGG - Intergenic
973719386 4:53707780-53707802 GGAATATGCCGGCTGGGGAGGGG + Intronic
974385760 4:61201004-61201026 GGAGGTTGCGGGCTTGAGAGGGG + Intergenic
977678576 4:99774154-99774176 CCAAGTTCCGGGGTTGGGAGAGG + Intergenic
978267996 4:106850005-106850027 GGAAGTGCCCGACTTGGAAAGGG + Intergenic
981042521 4:140236604-140236626 GGAAGTGCCCAGCTTGTGTGTGG - Intergenic
984704277 4:182836450-182836472 GGGAGTTCCCTGCTTAGTAGAGG - Intergenic
986177667 5:5365575-5365597 GGAAATTTCCTGCTGGGGAGAGG + Intergenic
992695309 5:79280129-79280151 GGAATTTCCAGGCTGGGCAGTGG - Intronic
995510356 5:112902837-112902859 GGCAGGACCCAGCTTGGGAGTGG - Intronic
997597531 5:135117032-135117054 GGAAGTTCATGGGGTGGGAGGGG + Intronic
998317813 5:141200430-141200452 GGCAGTTCCAGACCTGGGAGGGG - Exonic
998318759 5:141209563-141209585 GGCAGTTCCAGACCTGGGAGGGG - Exonic
999116783 5:149171202-149171224 GGAAGTTCCAGGCTAGGGTAGGG - Intronic
999275251 5:150325704-150325726 GGAAGTCCACGGCAAGGGAGAGG - Intronic
1002634863 5:180602236-180602258 GCTGGTTCACGGCTTGGGAGGGG + Exonic
1002931865 6:1640475-1640497 GGAGGTTCAAGGCTGGGGAGTGG - Intronic
1002985933 6:2190925-2190947 TGATGTTCCAGGCCTGGGAGCGG - Intronic
1014674713 6:124349295-124349317 GGAAGTTCCCGCCTTTGTAGGGG - Intronic
1016306772 6:142693188-142693210 GGAAATGCCTGGCTTGTGAGTGG - Intergenic
1019412875 7:914267-914289 GGAAGCTCGGGGCTTGGGAAGGG - Intronic
1019475508 7:1242326-1242348 GGGAGCTCCCGGCTTGTGGGGGG + Intergenic
1026846258 7:73700590-73700612 GGAAGGTGACGGCCTGGGAGGGG + Intronic
1028501201 7:91520686-91520708 TGCAGTTCCAGGCTTGAGAGTGG - Intergenic
1029697179 7:102221126-102221148 GGAATTTCCTGGCTTGGCATGGG + Intronic
1029959951 7:104680232-104680254 GGAGGTTCCCTGCTGAGGAGGGG - Intronic
1033345099 7:140520331-140520353 GGACTGTCCTGGCTTGGGAGGGG + Intronic
1036585476 8:10119429-10119451 TTAAGTCCCAGGCTTGGGAGTGG + Intronic
1037879414 8:22565731-22565753 AAAAGTTCGCGGCTCGGGAGGGG - Intronic
1038522986 8:28249180-28249202 AGAAATCCCCAGCTTGGGAGTGG + Intergenic
1043942320 8:86209883-86209905 GGAACATCCCGGATTTGGAGTGG + Intergenic
1049751733 8:144287890-144287912 GGAAGTTACGGCCTTGGCAGAGG - Intronic
1056999412 9:91493532-91493554 GGAAGTTCAAGTCTTGGGTGAGG + Intergenic
1057866640 9:98686898-98686920 GGAAGTACAGGGCTGGGGAGAGG - Intronic
1058500783 9:105613513-105613535 GGATGTTGCAGGCCTGGGAGGGG + Intronic
1060772409 9:126342203-126342225 GGGAGTTCCCGCTGTGGGAGAGG + Intronic
1061181376 9:129026977-129026999 GGGAGTGCCCGGGTTGGGGGTGG + Intronic
1061271682 9:129547259-129547281 GGAATTCCCCAGCGTGGGAGAGG - Intergenic
1061452781 9:130677641-130677663 GGAGCTTCCCCACTTGGGAGGGG + Intronic
1062036527 9:134384998-134385020 GGAAGCTCCTGGCCTGGGATGGG + Intronic
1203783126 EBV:112189-112211 GGGAGGTCCAGGTTTGGGAGTGG + Intergenic
1186214461 X:7283942-7283964 GCAAGTTCCTGGCGTTGGAGAGG + Intronic
1190318802 X:49167273-49167295 GGGCGTTCCCGGCACGGGAGAGG + Intronic
1191939462 X:66462787-66462809 GGAACTTTCTGGCTTGGCAGAGG - Intergenic
1193532685 X:82675102-82675124 TGTAGTTCCAGGCTTGAGAGTGG + Intergenic
1194366506 X:93019775-93019797 GGCAGTGCACAGCTTGGGAGTGG + Intergenic
1197729731 X:129799253-129799275 TGAATTTCCTGACTTGGGAGGGG - Intergenic
1200674734 Y:6136036-6136058 GGCAGTGCACAGCTTGGGAGTGG + Intergenic