ID: 934754828

View in Genome Browser
Species Human (GRCh38)
Location 2:96817543-96817565
Sequence GCCCTCTCCCTGAAAAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934754822_934754828 9 Left 934754822 2:96817511-96817533 CCGGGCATGGTGCAGGGGACGCC 0: 1
1: 0
2: 2
3: 15
4: 190
Right 934754828 2:96817543-96817565 GCCCTCTCCCTGAAAAGGGGTGG 0: 1
1: 0
2: 2
3: 14
4: 158
934754821_934754828 10 Left 934754821 2:96817510-96817532 CCCGGGCATGGTGCAGGGGACGC 0: 1
1: 0
2: 3
3: 19
4: 247
Right 934754828 2:96817543-96817565 GCCCTCTCCCTGAAAAGGGGTGG 0: 1
1: 0
2: 2
3: 14
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934754828 Original CRISPR GCCCTCTCCCTGAAAAGGGG TGG Intronic
901414476 1:9107151-9107173 GCCCCCTCCCTGCACAGGGAGGG + Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
903134964 1:21303208-21303230 GCCACCTCCCTGAACAGGTGAGG - Intronic
903726916 1:25454908-25454930 CTCATCTGCCTGAAAAGGGGGGG - Intronic
904836643 1:33342008-33342030 GACCTCTCCCAGAGAAGGGAAGG + Intronic
906263918 1:44414056-44414078 GCCTTCTCCCTTAAGTGGGGAGG - Intronic
912331326 1:108822632-108822654 GCCCTCTCCCAGAGAAGGAGAGG + Intronic
914448520 1:147771065-147771087 TCCCTGTCCCTGAAAACGGCAGG + Intronic
919764411 1:201116951-201116973 GCTCTCTCCCTGACAGGAGGAGG + Intronic
919980508 1:202640130-202640152 GCGCTCTTACTGAGAAGGGGAGG + Intronic
920081786 1:203380089-203380111 GCCCTCTCCCTGCACAGGGGAGG + Intergenic
921858554 1:220015720-220015742 TCCAGCTCCCTGACAAGGGGAGG - Intronic
922471493 1:225879922-225879944 GCATTGTCCCTGGAAAGGGGAGG + Intronic
922500940 1:226096489-226096511 GCCCTCTCCCTCTACAGTGGAGG + Intergenic
922995968 1:229961924-229961946 GTCCTCCCCTTGAAATGGGGAGG - Intergenic
924325849 1:242893180-242893202 GCACTGTCTCTGAAAAGGAGAGG - Intergenic
1063369372 10:5511310-5511332 GCCTTCTCTCTGCAAAGGGAAGG + Intergenic
1064601664 10:16999892-16999914 GTCCTCTCCCTGCAGAGGGAAGG - Intronic
1067385873 10:45817427-45817449 GCCCTCTCCCTGGACTGGGAGGG - Exonic
1068915838 10:62430501-62430523 CCCATCTTCCTAAAAAGGGGAGG + Intronic
1070597577 10:77843441-77843463 GCCCTCTCCCTGAGGAGGTAGGG - Exonic
1071330406 10:84553134-84553156 ACCCTCTCCCCAAAAAGGGAAGG - Intergenic
1074721748 10:116271165-116271187 GCCCTCGCCCGGAGCAGGGGCGG - Intronic
1076603447 10:131674220-131674242 TCCCTGTCCCTGAAAATGTGAGG - Intergenic
1079147424 11:17866508-17866530 TCCCTCTCTCTCAAAAAGGGGGG - Intronic
1080691700 11:34564099-34564121 GCCCTGTCCCTGAAGATGAGGGG + Intergenic
1084275608 11:68049647-68049669 GCCCTCTCCCTGGCAGGAGGTGG + Exonic
1086545815 11:87966235-87966257 GCCCTCCCCCTATGAAGGGGAGG - Intergenic
1090200132 11:124848173-124848195 GCCCTCATCCTGATAAGTGGAGG + Intergenic
1090562470 11:127947399-127947421 CCCCTCTCCCTGAAGATGGTGGG + Intergenic
1093528291 12:20130949-20130971 GGTCTCACCCTGAAAAGGAGAGG + Intergenic
1102152632 12:110699294-110699316 CCCCTCTTCCTGCCAAGGGGTGG + Intronic
1103279885 12:119748497-119748519 GCCTTCACCCTGAAAGGGGGTGG - Intronic
1104825146 12:131702517-131702539 GCCCTCTACCTGGGAAGTGGAGG + Intergenic
1104946242 12:132416068-132416090 GTCCTCTCCTTGAAAAGGCCAGG - Intergenic
1106024374 13:25942940-25942962 GCCCTGTCCATGGACAGGGGAGG - Intronic
1108557798 13:51612807-51612829 ACCCTCTACCTGTAAGGGGGAGG - Intronic
1109734899 13:66469888-66469910 GCCCTGTCCATGAAATGCGGTGG - Intronic
1113387174 13:109859494-109859516 GCCTTCTCCCTGAGATGGTGGGG + Intergenic
1118031049 14:61818255-61818277 TGCCTCTCCCAGAAAAGTGGGGG - Intergenic
1120996363 14:90421307-90421329 GGACTCTCCCTGAAAAGGCATGG + Intergenic
1121429152 14:93874635-93874657 CCCCTCTTCTTAAAAAGGGGAGG + Intergenic
1121713347 14:96055278-96055300 GCAGTCTCCCTGAAAAGAGTGGG - Intronic
1122425848 14:101604847-101604869 GTCCTCTCCCTCAGGAGGGGTGG + Intergenic
1122461498 14:101899346-101899368 GCCCGCTCCCTGCAGAGGGCAGG - Intronic
1124014037 15:25861777-25861799 GCCCTGTCCCTGAGAAAGGTGGG - Intronic
1124496205 15:30188957-30188979 GCGCTCTTACTGAGAAGGGGAGG + Intergenic
1124505715 15:30271484-30271506 GCTCTTTCTCTGACAAGGGGAGG - Intergenic
1124737838 15:32267148-32267170 GCTCTTTCTCTGACAAGGGGAGG + Intergenic
1124747369 15:32349690-32349712 GCGCTCTTACTGAGAAGGGGAGG - Intergenic
1125487482 15:40122403-40122425 TCCCTTTCCCAGAAAAGGGAAGG + Intergenic
1128215407 15:65930935-65930957 GACCTCTCCCTGGAAAGGGAGGG + Exonic
1129332024 15:74832615-74832637 GCACTATCCCTGGAATGGGGTGG + Intergenic
1131396709 15:92092076-92092098 GCCCTCTTGCAGAAAAGGAGGGG - Intronic
1132283692 15:100643292-100643314 TCCCTCTCCTTGAAACTGGGTGG - Intronic
1132404604 15:101534904-101534926 GTCCTCTCCATGGAAACGGGGGG - Intergenic
1132876866 16:2143890-2143912 CCCCTCTCCATGAAATGAGGGGG - Intronic
1136044061 16:27601796-27601818 GCCGGCCCCCTGAAGAGGGGAGG - Intronic
1136654849 16:31703592-31703614 CTCCTCTCCCTGAACAGGGCTGG - Intergenic
1137673135 16:50291069-50291091 GCCCTCTCTCTCAACTGGGGTGG - Intronic
1138504722 16:57472531-57472553 CCCCTCTCACTGACCAGGGGTGG - Exonic
1138510795 16:57507552-57507574 GCCCCCTCCCTGGGATGGGGAGG + Intergenic
1139589789 16:67927223-67927245 CACCTCTCTCTGGAAAGGGGAGG + Intronic
1140755017 16:78059141-78059163 CCTCTCTCCCTGATAAGGGGAGG + Intronic
1141539060 16:84704839-84704861 GCCCTCTCCTGGAATAGGGCAGG + Exonic
1144852647 17:18251805-18251827 GCCCACTCCCTGCTTAGGGGAGG + Exonic
1145865369 17:28237831-28237853 CCCCTCTCCCTGGTAAGGGGAGG + Intergenic
1146595933 17:34168632-34168654 GCCTTTTCCCTGAGATGGGGGGG + Intronic
1146796270 17:35783625-35783647 GCCAACTCCCTGATAAGGGCTGG - Intronic
1149350161 17:55778674-55778696 GTCCTCTCTCTGTTAAGGGGTGG + Intronic
1154501569 18:15000221-15000243 GTCCTCTCCCTGCGATGGGGCGG + Intergenic
1156608902 18:38702901-38702923 GCCCTCTCCAAGGAAATGGGAGG - Intergenic
1159687286 18:71438330-71438352 TCCCTCTCCCTGAGAGAGGGAGG - Intergenic
1160408507 18:78659329-78659351 GCCCTTTCCCTGGAGCGGGGAGG + Intergenic
1163404970 19:17116468-17116490 TCACTCTCCCTTAAAAGAGGTGG - Intronic
1163638737 19:18450042-18450064 TGCCTCTCCCTGAATAGGGCTGG + Intronic
1163966870 19:20754129-20754151 CCTCTCTCCCTGATAAGGGGAGG + Intronic
1165923155 19:39311097-39311119 CCTCTGTCCTTGAAAAGGGGTGG - Intronic
1167969146 19:53175726-53175748 GCCCTTTTCAGGAAAAGGGGAGG - Intronic
930642856 2:53872007-53872029 TCCCTCTCCAAAAAAAGGGGGGG + Intronic
931727071 2:65121768-65121790 CCCCTCTCCCTCTAAAGCGGGGG + Intronic
932777146 2:74535222-74535244 CCCCTTTCCCTGCAAACGGGTGG + Intronic
932976687 2:76610572-76610594 GTCCTCTCCAAGAAAAGGAGGGG + Intergenic
933553354 2:83802870-83802892 ACCCTCTCCCTGTGCAGGGGCGG - Intergenic
934045990 2:88172894-88172916 ACCCTCTCCCTGAAGACAGGAGG + Exonic
934504709 2:94880927-94880949 GACCTGTCCCTGAAAAGAGAGGG - Intergenic
934754828 2:96817543-96817565 GCCCTCTCCCTGAAAAGGGGTGG + Intronic
938202594 2:129387399-129387421 GCCCTCTCCATCCAAAGCGGTGG - Intergenic
938322555 2:130374751-130374773 GCCCTATCCCAGAGAAGGGCAGG - Exonic
941650361 2:168085783-168085805 GCCCTCTCCTTGAATCTGGGTGG + Intronic
947219676 2:227780332-227780354 ACCGACTCCATGAAAAGGGGAGG + Intergenic
948874346 2:240819159-240819181 GCCCTCTCGCTGGGAAGGGCCGG - Intronic
1170163481 20:13339343-13339365 ACCCTCTGCCTGAAATGGTGAGG + Intergenic
1171278570 20:23878637-23878659 GCCCTCTCCCTGCACAGGAGGGG - Intronic
1171283651 20:23921141-23921163 GCCCTCTCCCTGCACAGGAGGGG - Intergenic
1171424885 20:25043065-25043087 GCCCTGTCCCTGGCAGGGGGAGG - Intronic
1175474833 20:59264845-59264867 GCCCTCTCCTTGCAAATGGGTGG - Intergenic
1178823392 21:35994999-35995021 CCTATCTTCCTGAAAAGGGGAGG - Intronic
1184208118 22:43018072-43018094 GCCCCTTGGCTGAAAAGGGGTGG - Intergenic
1184770800 22:46595444-46595466 GCCCTGTGTCTGGAAAGGGGAGG + Intronic
1185251516 22:49804140-49804162 GCCCTCTCCCTGGAGGGTGGGGG + Intronic
955876486 3:63495290-63495312 CTCCTTTCCCTGACAAGGGGTGG + Intronic
956744851 3:72303227-72303249 GCCCTCTCCAGGAAAATGTGTGG - Intergenic
956980993 3:74637135-74637157 GCCCTCTCCATGGAATGTGGGGG + Intergenic
962379691 3:134888078-134888100 TCCCTGTCCTTGAAAACGGGTGG + Intronic
962756582 3:138469549-138469571 CCTCTCTCCCTGAGAAGGGCTGG - Intronic
965863058 3:173170268-173170290 GCTCTCTCTCTGAATAGGAGAGG + Intergenic
967270430 3:187728320-187728342 TCCTTCTCCCTGACAAGAGGAGG + Intronic
969612904 4:8236993-8237015 GCACTCACCCTGAAAAGGGGAGG + Intronic
969749412 4:9098901-9098923 CCTCTCTCCCTGGTAAGGGGAGG - Intergenic
972992240 4:44834830-44834852 GCCATCTCCCTGAAGAAGGAAGG - Intergenic
974468839 4:62292950-62292972 GCCCTCTCCCTAAAAATCCGTGG + Intergenic
977013179 4:91659587-91659609 CCCCTCTCCCAGAAAAGCAGAGG + Intergenic
977337952 4:95721604-95721626 GTCCTCTCCCTGAAGTGGGGAGG + Intergenic
984838369 4:184043504-184043526 TACCTCTTCTTGAAAAGGGGAGG - Intergenic
985588260 5:751763-751785 GGCCTCTCGCTGGAGAGGGGTGG + Intronic
985602931 5:844218-844240 GGCCTCTCGCTGGAGAGGGGTGG + Intronic
985669728 5:1201173-1201195 TCCCTCTCCCTGGACTGGGGTGG + Intergenic
986018535 5:3779525-3779547 GCCCTCCTCCTGAAAAGGCGCGG - Intergenic
986307076 5:6523925-6523947 TCCGTCTCCCTGAGAAGGGCAGG - Intergenic
987178514 5:15341712-15341734 GCACTCTCACAGAGAAGGGGAGG + Intergenic
990991077 5:61684600-61684622 GCCCTCTCACTGATATGGAGAGG + Intronic
994013889 5:94942299-94942321 GCCCACTGCATGACAAGGGGTGG + Intronic
999525918 5:152405330-152405352 GCCCTCAGCCTGTCAAGGGGAGG - Intronic
1001036353 5:168299579-168299601 GCCCTCTCCCCGGGAGGGGGAGG - Intronic
1001964474 5:175900711-175900733 GCCCTCTCGATGGAATGGGGAGG + Intergenic
1002882261 6:1263415-1263437 GCCCGCTCCCTGAAACAGGGAGG + Intergenic
1003307343 6:4941480-4941502 TCCCATTCCCTGAAAAGGGAAGG + Intronic
1004429028 6:15526799-15526821 GCCATCTTCTTGAAAAGGGCAGG + Intronic
1007064577 6:38977100-38977122 CCCTTCTCCCAGAAAAGGAGAGG - Intronic
1007281329 6:40714484-40714506 CCCATCTGCCTGAAATGGGGTGG - Intergenic
1011112073 6:83849707-83849729 TCCATCTCACTGAAAAGGAGTGG - Intergenic
1015542276 6:134326946-134326968 GCCCTAACCCTGAAATGTGGTGG - Intergenic
1017955410 6:159173634-159173656 GCCCGTTCCCTGAAAACAGGAGG + Intronic
1018907657 6:168084837-168084859 GCTCTCTCCCTGTGATGGGGAGG - Intergenic
1019110843 6:169712290-169712312 ACCCTCTCCTTGAAAAAGGATGG - Intronic
1019322164 7:420725-420747 GCCTTCCCCTTCAAAAGGGGTGG + Intergenic
1019630913 7:2049356-2049378 ACCCTCTCCCTGCACAGTGGGGG + Intronic
1020323581 7:6957739-6957761 CCTCTCTCCCTGGTAAGGGGAGG + Intergenic
1022415014 7:30170129-30170151 GCCATCCCCCTGAAATAGGGTGG + Intergenic
1026101571 7:67388602-67388624 GCACACTCCCAGGAAAGGGGCGG - Intergenic
1036122689 8:6035530-6035552 GCCATTTCCTTGAACAGGGGAGG - Intergenic
1036817141 8:11910621-11910643 CCTCTCTCCCTGGTAAGGGGAGG + Intergenic
1038798594 8:30730048-30730070 CCTCTCTCCCTGGTAAGGGGAGG - Intergenic
1039555426 8:38471789-38471811 GCTCTTTCCCTGAGAAGTGGAGG - Intergenic
1040023897 8:42764160-42764182 TTCCTCTCCCTGCAATGGGGGGG + Intronic
1041179082 8:55229200-55229222 GCCCACTCTCTGAAAGGGGCCGG + Intronic
1042368808 8:67967764-67967786 GGCCTTTCCCTGAAAGGGGATGG + Intronic
1043150427 8:76707738-76707760 GCTCTCTCCCTGAAGAGGAATGG + Exonic
1044316110 8:90751418-90751440 GGCCTTTCCCTGGAAAGGGTGGG + Intronic
1045480347 8:102586559-102586581 GCCGTTTCCCTGAAAGGGGGTGG - Intergenic
1046439842 8:114242563-114242585 CCCCTCTCCCAGAAAAGCAGAGG - Intergenic
1047340700 8:123977662-123977684 GCCCTCATCTTTAAAAGGGGTGG + Intronic
1047810125 8:128399312-128399334 ACTCTCTCCTTGACAAGGGGTGG + Intergenic
1047848813 8:128833997-128834019 GACCTCTTCCAGAAAACGGGTGG - Intergenic
1049606577 8:143532423-143532445 GCCGTCTCCTTGAAGAGGAGAGG + Intronic
1049735563 8:144202932-144202954 GCCCGCTCTCTGTAGAGGGGCGG + Intronic
1049806839 8:144544943-144544965 TCCCGCTCCCTGACAAGGGCAGG - Intronic
1050366434 9:4877808-4877830 ACCCTGTCTCTGAAAAGGGGAGG - Intronic
1053240070 9:36487825-36487847 CGCCGCTCCCTGAGAAGGGGAGG + Intergenic
1055602666 9:77935946-77935968 GCCTTCTTCCTGCAAAGGGAAGG + Intronic
1056694366 9:88833645-88833667 GCCCTCAGCCTGAAAGGAGGAGG - Intergenic
1056935972 9:90914915-90914937 GCCATGTCCCTGACATGGGGTGG + Intergenic
1057883159 9:98808326-98808348 ATCATCTCCCTGAAAAGGTGAGG + Intronic
1058893970 9:109383953-109383975 GGCCTCCCCCTCAAAAGGGTGGG - Intronic
1062224697 9:135443131-135443153 CCTCTCTCCCTGGTAAGGGGAGG + Intergenic
1062498926 9:136844125-136844147 GTCCTCTCCCTGCGATGGGGCGG - Intronic
1187518273 X:19991311-19991333 GCCCTCTCGCCGGAAAGGAGGGG + Intergenic
1190041862 X:47078401-47078423 GCCCCCTCCCTGGAAAGGAAAGG + Exonic
1191111013 X:56803221-56803243 GCCCTCTCCGAAAAAAGGGCAGG + Intergenic
1191711302 X:64152505-64152527 GCCCTCCCTGTGAAGAGGGGTGG + Intergenic
1196864590 X:120059328-120059350 CCCCTCTGCCTGAACAGGGAAGG + Intergenic
1196878511 X:120177003-120177025 CCCCTCTGCCTGAACAGGGAAGG - Intergenic
1198090677 X:133326208-133326230 GCTCTCTCCCTGAAAGTGAGAGG + Intronic
1201223301 Y:11791723-11791745 GCACTGTCTCTGAAAAGGAGAGG - Intergenic