ID: 934759019

View in Genome Browser
Species Human (GRCh38)
Location 2:96843279-96843301
Sequence CGCCAGAGGCTGCACCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 317}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934759011_934759019 -6 Left 934759011 2:96843262-96843284 CCCTGCCATTTGCCTCCCGCCAG 0: 1
1: 0
2: 0
3: 16
4: 236
Right 934759019 2:96843279-96843301 CGCCAGAGGCTGCACCAGGCTGG 0: 1
1: 0
2: 1
3: 30
4: 317
934759009_934759019 4 Left 934759009 2:96843252-96843274 CCTAACACCTCCCTGCCATTTGC 0: 1
1: 0
2: 0
3: 23
4: 265
Right 934759019 2:96843279-96843301 CGCCAGAGGCTGCACCAGGCTGG 0: 1
1: 0
2: 1
3: 30
4: 317
934759010_934759019 -3 Left 934759010 2:96843259-96843281 CCTCCCTGCCATTTGCCTCCCGC 0: 1
1: 0
2: 1
3: 34
4: 307
Right 934759019 2:96843279-96843301 CGCCAGAGGCTGCACCAGGCTGG 0: 1
1: 0
2: 1
3: 30
4: 317
934759012_934759019 -7 Left 934759012 2:96843263-96843285 CCTGCCATTTGCCTCCCGCCAGA 0: 1
1: 0
2: 1
3: 10
4: 144
Right 934759019 2:96843279-96843301 CGCCAGAGGCTGCACCAGGCTGG 0: 1
1: 0
2: 1
3: 30
4: 317
934759008_934759019 25 Left 934759008 2:96843231-96843253 CCTTCTAAAGAACTCTAGCAACC 0: 1
1: 0
2: 0
3: 12
4: 110
Right 934759019 2:96843279-96843301 CGCCAGAGGCTGCACCAGGCTGG 0: 1
1: 0
2: 1
3: 30
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934759019 Original CRISPR CGCCAGAGGCTGCACCAGGC TGG Intronic
900228064 1:1542035-1542057 CTCCAGAGGCGGCTCCATGCGGG + Exonic
900342246 1:2194691-2194713 CGCCGGAGGCCGCGCCCGGCGGG - Exonic
900358935 1:2278734-2278756 TGCTGGAGGCTGCCCCAGGCTGG + Intronic
900369022 1:2323301-2323323 CGCCAGAGGCAGCTCCACGGTGG + Intronic
900415598 1:2533070-2533092 GGCTGGAGGCTGCTCCAGGCTGG + Intergenic
900430222 1:2597852-2597874 GGCCAGAGGCAGGAGCAGGCAGG - Intronic
900582334 1:3415331-3415353 CGCCATGGGCTGCACCTGGAGGG + Intronic
900807306 1:4775956-4775978 CTACAGAGGCTTTACCAGGCGGG - Intronic
901060273 1:6468632-6468654 GGCCTGAGGCAGCCCCAGGCTGG + Intronic
901148644 1:7085727-7085749 CGGCAGAGGCTGCCCCATGGGGG - Intronic
901202269 1:7473444-7473466 CTCCAGAGGCTGTAGCAGCCTGG - Intronic
901232472 1:7648889-7648911 CGCCAGAGGCTGCTATAGGCCGG - Intronic
901794786 1:11673877-11673899 AGCCAGAGGTTCCTCCAGGCAGG + Exonic
902610901 1:17596629-17596651 TCCCAGAGGCTGCACCATGTGGG - Intronic
902939059 1:19786589-19786611 TGCCAAGGGCTGCCCCAGGCAGG + Intronic
904005126 1:27359609-27359631 TGACAGAGGCAGGACCAGGCTGG - Intronic
904038684 1:27572030-27572052 TGCCAGACCCTGCACCAGCCTGG + Intronic
904126889 1:28247225-28247247 CGCCACAGCCTGCACCAATCAGG + Intergenic
904550345 1:31311608-31311630 CTCCAGAGGATGCAGCAGGAAGG - Intronic
904781688 1:32954455-32954477 CGTGAGTGACTGCACCAGGCCGG - Intronic
905304073 1:37005544-37005566 CGCCAGGGGCTGGGCCAGCCAGG + Intronic
906510996 1:46410478-46410500 CACCAGAGGCTTCACCAGGAAGG - Exonic
906719693 1:47996552-47996574 CGCCCGAGGCTGCGCCCGGGGGG + Intronic
907251039 1:53139603-53139625 AGCAAGATGCTGCACTAGGCAGG - Intronic
910371666 1:86523488-86523510 AGCCAGCGGCTGCAACAGGTTGG - Intergenic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
913398714 1:118403732-118403754 AGCCTGAAGCTGCACCAGGCAGG + Intergenic
913411957 1:118561961-118561983 CACCAGAGGCTGGAGGAGGCAGG + Intergenic
915038623 1:152949020-152949042 CAGGAGAGGCAGCACCAGGCTGG + Intergenic
920840974 1:209553474-209553496 AGTCAGAGGCTGTAGCAGGCAGG - Intergenic
921088135 1:211815716-211815738 GGCCAGTGGCTGCAGCAGGGAGG - Intronic
921185964 1:212669780-212669802 CGGCACAGGCTGCAGCTGGCAGG + Intergenic
921930238 1:220748673-220748695 CGCCGGCGGCTGCAGCAGGTGGG + Exonic
922533915 1:226365695-226365717 AGGCAGAGGCTGCAGCAGGCCGG + Intronic
922782441 1:228263896-228263918 CACCAAGGGCTGCCCCAGGCAGG - Intronic
924643641 1:245857251-245857273 CGGCAGAGGCTCCACCAGCCAGG - Intronic
1063048604 10:2420214-2420236 CACCAGAGGCTGGAAGAGGCAGG + Intergenic
1066061109 10:31724309-31724331 TGCCAGCTGCTGGACCAGGCTGG + Intergenic
1068805801 10:61192727-61192749 CTCCAGAGGCTGCACACAGCAGG + Intergenic
1070098137 10:73358541-73358563 CGGCAGAGTCCGCACCTGGCCGG + Intronic
1070280369 10:75043979-75044001 CGCTATAGGCTGCAGAAGGCGGG - Exonic
1072549720 10:96468345-96468367 TGACAGAGGCTCCAGCAGGCTGG + Intronic
1072750076 10:97972123-97972145 AACCAGGGGCTGCCCCAGGCTGG - Intronic
1075702271 10:124477419-124477441 CCCCAGAGGCAGGAGCAGGCTGG + Intronic
1076036791 10:127205351-127205373 ACCCAGAGGATGAACCAGGCAGG - Intronic
1076215451 10:128689652-128689674 CGGGAGAGGCTGCACTGGGCTGG - Intergenic
1076375772 10:129983731-129983753 GCCCAGAAGCTGCAGCAGGCAGG + Intergenic
1076519572 10:131073275-131073297 CCGCAGAGGCAGCACCAGACTGG - Intergenic
1076564406 10:131388334-131388356 TGCCAGAGTGTGCACCAGTCAGG - Intergenic
1076881238 10:133240185-133240207 CGCCAGAGGCTGCCCGCAGCAGG - Exonic
1077765080 11:5149930-5149952 AGCCAGAGGATCCACCAGGTGGG + Intergenic
1077866380 11:6224642-6224664 AGCCAGAGGTTATACCAGGCTGG + Exonic
1078545826 11:12246271-12246293 AGCCAGAGACAGCAGCAGGCAGG - Intronic
1079192781 11:18294928-18294950 GGCCACAGGCTGCACAAGGTTGG + Intronic
1079355600 11:19727868-19727890 CTCCAGAGTCTGCACGAGGAAGG + Intronic
1080584378 11:33667976-33667998 CGCCGGGGCCTGCTCCAGGCTGG - Exonic
1080779878 11:35419841-35419863 CGCCAGGGGCTGCTCCAGGGAGG - Intronic
1081997982 11:47377107-47377129 AGCCACAGGCAGGACCAGGCAGG - Intronic
1083672246 11:64305936-64305958 AGCCAGATCCTGCCCCAGGCCGG - Intronic
1084124877 11:67092807-67092829 CTCAAGAGGCTGAAGCAGGCTGG - Intergenic
1084322533 11:68381588-68381610 CGCCCGAGCCTCCTCCAGGCGGG - Intronic
1084398127 11:68928001-68928023 CGCCAAAGGCTGCAGCAATCAGG - Intronic
1084604391 11:70164098-70164120 TGACAGAGGCTGAACCAGGCTGG - Intronic
1085366143 11:75946948-75946970 CGCCAGAAACTGAACCATGCTGG - Intronic
1085482841 11:76837020-76837042 CACGGGAGGCTGCTCCAGGCAGG - Intergenic
1086037865 11:82438714-82438736 TGCCTGAGGCTGCACAAGGTGGG + Intergenic
1088119152 11:106347637-106347659 TGCCAGAGGCTGGAGGAGGCAGG - Intergenic
1088495782 11:110430184-110430206 GGCCGGTGGCTGCACCACGCTGG + Exonic
1089144276 11:116313070-116313092 CGGGAGAGGCAGCACCAGCCCGG + Intergenic
1089479282 11:118791776-118791798 GCCCGGAGGCCGCACCAGGCAGG + Intergenic
1090393839 11:126406428-126406450 AGCTAGAGGCAGCAACAGGCAGG - Intronic
1090575868 11:128102886-128102908 GGTGAGAGGCTGCAGCAGGCTGG + Intergenic
1091322359 11:134660796-134660818 AGACAGACCCTGCACCAGGCTGG + Intergenic
1091702603 12:2674001-2674023 CCCCAGAGGCTGCATAAGGCAGG + Intronic
1096773972 12:53953094-53953116 CGGGAGGGGCTGGACCAGGCCGG + Intergenic
1098351775 12:69570063-69570085 CAACAGAGGCTGCAGAAGGCAGG - Intronic
1098750985 12:74292974-74292996 CGCCAGAGGCTGCCCACAGCAGG - Intergenic
1099069603 12:78029059-78029081 GACCAGAGGCTGTGCCAGGCAGG - Intronic
1100839069 12:98593825-98593847 CGAAAGAGGCTGCTCCCGGCTGG - Intronic
1100981453 12:100165883-100165905 AGCCAGAGGCAGCTCCAGCCTGG - Intergenic
1101447432 12:104747238-104747260 CCCAGGAGGCTGCACCATGCAGG + Intronic
1101737207 12:107471991-107472013 CCCTAGAGACTGCATCAGGCTGG - Intronic
1102145984 12:110655479-110655501 CGCCAGAGGCCCCACCAGGATGG + Intronic
1102933312 12:116878706-116878728 CGCCAGAGGCTGCAGAACCCTGG + Intronic
1103134673 12:118497459-118497481 CAACAGAGGCTGGACCAAGCAGG - Intergenic
1104409691 12:128547774-128547796 CACCAGCGGCTTCCCCAGGCAGG + Intronic
1104810900 12:131619895-131619917 GGGCAGTGGCTGCACCAGCCAGG - Intergenic
1104930965 12:132339297-132339319 CGCCGGAGGCTGGCCCAGGTGGG - Intergenic
1105505524 13:21006242-21006264 GGCCAGAGCCTGCAAGAGGCTGG + Intronic
1105890680 13:24680552-24680574 CGCCAGCCGCTGCACCGGGGAGG - Exonic
1107597840 13:41981646-41981668 CGCCAGAGGCTGCAGCTAGGAGG + Intergenic
1110219704 13:73059661-73059683 CGACAGGGGCCGCTCCAGGCTGG + Intronic
1113615018 13:111674207-111674229 CCCCTGAGGCTGGACCAGACAGG + Intergenic
1113714860 13:112496348-112496370 CACCAGGGGGTGCAGCAGGCGGG + Intronic
1114405508 14:22452697-22452719 AGGCAGAGGCTGGGCCAGGCAGG - Intergenic
1117315425 14:54567194-54567216 CGCCCGAGGCCACCCCAGGCGGG + Intronic
1118722510 14:68604439-68604461 CGCCAGTGGCTGCACCAGCCAGG + Intronic
1120968618 14:90189608-90189630 CTCCAGAGGGTGAACCAAGCTGG + Intergenic
1122016021 14:98797300-98797322 AGCCTGAGGCTGAACCTGGCAGG + Intergenic
1122541471 14:102499952-102499974 CAGCAGAGGCAGCCCCAGGCCGG + Exonic
1122866125 14:104604775-104604797 CGCGGGAGGCTGCGCCGGGCGGG + Exonic
1122972547 14:105158278-105158300 AGCCAGAGGCCCCAACAGGCCGG + Intronic
1123473158 15:20569489-20569511 GGCCAGAGGCAGCTCCAGCCCGG + Intergenic
1123644848 15:22430864-22430886 GGCCAGAGGCAGCTCCAGCCCGG - Intergenic
1123733459 15:23164500-23164522 GGCCAGAGGCAGCTCCAGCCCGG + Intergenic
1124078986 15:26474000-26474022 TGTTAGAGGCTGGACCAGGCAGG - Intergenic
1124564047 15:30798860-30798882 AGCCAGAGGCAGCTCCAGCCTGG + Intergenic
1125727525 15:41875670-41875692 CACCAGTGGCCGCAGCAGGCTGG + Intronic
1127365103 15:58282208-58282230 AGCCATAGGCTGCATCTGGCTGG + Intronic
1127773019 15:62245593-62245615 GGCCAGAGGCAGCTCCAGCCTGG - Intergenic
1127850654 15:62909342-62909364 TGCCAGTGGCTGCAGGAGGCTGG - Intergenic
1127976120 15:63998501-63998523 TGCCAGAGGCTGGGCCTGGCTGG + Intronic
1128345070 15:66848336-66848358 AGCCACAGGCTGGATCAGGCAGG - Intergenic
1128643548 15:69358478-69358500 CACCAGAGGCTGCCCCTGGACGG - Intronic
1128721658 15:69954883-69954905 CGGCTGCGGCTGCACCTGGCAGG + Intergenic
1129198480 15:73984789-73984811 CGCCAGAGGCTGCTTCGGACTGG + Exonic
1129231527 15:74199633-74199655 GGCCAGAGGCTCCCCCAGGCAGG - Intronic
1129252272 15:74315589-74315611 TTCTAGAGCCTGCACCAGGCAGG - Intronic
1129605284 15:77021936-77021958 CCCCAGAAGCTGCACAGGGCAGG + Intronic
1129741645 15:77992413-77992435 CGGCAGAGGTTGCTGCAGGCTGG + Intronic
1131171933 15:90184971-90184993 CCCCAGGGGCTGCGCCGGGCCGG + Intronic
1132613833 16:830722-830744 CGCCAGGGGCTGGAAGAGGCAGG - Intergenic
1132745923 16:1436271-1436293 CCTCAGAGGCTGCACCAGGGTGG + Intronic
1132907429 16:2290036-2290058 CAACTGAGGCTGCAGCAGGCAGG + Intronic
1133218211 16:4306382-4306404 GACTAGAGGCTGCACCAGGCTGG + Intergenic
1134043233 16:11083764-11083786 CGCCACAGGCAGCAGGAGGCTGG - Intronic
1135039526 16:19107349-19107371 AGGCAGAGGTTGCAGCAGGCCGG - Intergenic
1136169802 16:28482175-28482197 TACCAGATGCTGTACCAGGCTGG - Exonic
1139356770 16:66371422-66371444 GTCCAGAGGCTGCAGGAGGCTGG + Intronic
1139562753 16:67754227-67754249 AGCCAGCGGCTGAACAAGGCAGG + Intronic
1141141600 16:81500114-81500136 CGCCAGAGGCTGGGGCTGGCAGG - Intronic
1141542684 16:84738146-84738168 CCCGAGAGACTGCAGCAGGCTGG - Intronic
1141885722 16:86890926-86890948 TGCTAGAGGCTGACCCAGGCAGG + Intergenic
1142034843 16:87856527-87856549 GGCCACAGGCTGCACTGGGCGGG - Intronic
1142159430 16:88549126-88549148 CGGCAGTGGCTGCACGAGGCAGG + Intergenic
1142574075 17:894695-894717 CTGCAGAGGCTGCCCCCGGCAGG - Intronic
1143432208 17:6895442-6895464 CCCTGGAGGCAGCACCAGGCAGG - Intronic
1143495135 17:7308194-7308216 CCTCAGAGACTGCGCCAGGCCGG - Intronic
1143525212 17:7467920-7467942 CTCCAGAGGCTGGAGCAAGCTGG - Intronic
1143651036 17:8264492-8264514 GGCCAGAGGCTGCAGCATGGGGG - Exonic
1144090604 17:11852559-11852581 AACCAGGGGCTGCTCCAGGCTGG - Intronic
1144959809 17:19038744-19038766 TGCCACAGGCTGCAGCAGGAGGG + Intronic
1144975351 17:19135780-19135802 TGCCACAGGCTGCAGCAGGAGGG - Intronic
1148786544 17:50148791-50148813 CTCCAGAGGCTGCCAGAGGCTGG - Intronic
1151416628 17:73970519-73970541 CAGCAGAGGCTGCATCAGGAGGG - Intergenic
1152214596 17:79024890-79024912 TGCCCGCGGCTGCACCTGGCGGG + Intronic
1152302686 17:79504547-79504569 CCCCAGAGGCTGGAAGAGGCAGG - Intronic
1152600006 17:81257558-81257580 GGCCAGAGGCTGCAGGAGGCAGG - Intronic
1152646032 17:81468970-81468992 CTCCTGAGTCTGTACCAGGCAGG + Intergenic
1154321122 18:13353745-13353767 AGCCCAAGGCTACACCAGGCTGG + Intronic
1155022856 18:21912517-21912539 CCCCACAGGCTGCAGCAGCCAGG - Intergenic
1157358372 18:46955657-46955679 CTCCAGAGGCTGAAGCAGGAGGG - Intronic
1158949337 18:62477671-62477693 CTCCAGAGGCTGCAGCAGCAAGG + Intergenic
1160229366 18:77034762-77034784 AGGCAGGGGCTGCACCAGGTGGG - Intronic
1160252413 18:77214469-77214491 TGCCAGAGGCTGGGCAAGGCAGG - Intergenic
1160911335 19:1475150-1475172 AACCAGCGGCTGCAGCAGGCGGG - Exonic
1161366295 19:3881673-3881695 CGCCTGTGGCTGCAGCTGGCAGG + Intronic
1161505421 19:4640964-4640986 GGCCAGAGGCTGGAGCAGCCTGG + Intronic
1161809691 19:6464712-6464734 CGCCAGAAGCAGCCCCAGCCCGG - Exonic
1161884475 19:6983211-6983233 CACCAGAGGCTGGAAGAGGCAGG - Intergenic
1162028327 19:7906421-7906443 CTCCAGAGGTTCCCCCAGGCTGG - Intronic
1162935464 19:13979483-13979505 GGTCAGCGGCTGCACCGGGCCGG + Exonic
1163013718 19:14441059-14441081 GGGCAGAGGCTGGGCCAGGCTGG + Intronic
1163055704 19:14716040-14716062 CGCCAGAGGATGCTGGAGGCTGG - Intronic
1163359346 19:16836080-16836102 CGCCAAAGGCTGCCCGAGGCTGG - Intronic
1163549956 19:17960761-17960783 CACCAGAGGCTGGAAGAGGCAGG - Intronic
1164465119 19:28481380-28481402 TCGCAGAGGCTACACCAGGCTGG + Intergenic
1164683716 19:30153008-30153030 AGCCAGAGGCCCCACCAAGCAGG - Intergenic
1164720963 19:30431253-30431275 CGGCAGAGGCTGGGCCAGTCTGG + Intronic
1165079927 19:33301298-33301320 CGCCGGAGGCTGGCCCAGGGCGG + Exonic
1167258413 19:48444054-48444076 CGCAGGACGCTGCTCCAGGCGGG - Exonic
1167499156 19:49835840-49835862 GGCCAGAAGCTGCTCCAGGAGGG - Exonic
925361350 2:3282685-3282707 CTCCCGAGTCTGCACCAGGCCGG + Intronic
925900908 2:8508854-8508876 AGCCAGAGGCTGGGCCAGACAGG + Intergenic
926006372 2:9376229-9376251 CGCCAGAGGGCCCAGCAGGCAGG + Intronic
926052368 2:9753232-9753254 TGCCTGAGCCTGCACCAAGCAGG - Intergenic
927390286 2:22587454-22587476 TGCCAGTGGCTCCAACAGGCTGG - Intergenic
928392784 2:30922050-30922072 CCACAGAAGCTGGACCAGGCTGG + Intronic
929195481 2:39180362-39180384 TGCCTGAGGCTGCCCCAGCCGGG + Intronic
930051208 2:47217604-47217626 AACCAGTGGCTGCATCAGGCAGG - Intergenic
932619786 2:73258720-73258742 TGCCAGAGGCTACTCCAGCCGGG + Exonic
932946497 2:76238664-76238686 CAACAGACACTGCACCAGGCTGG + Intergenic
934759019 2:96843279-96843301 CGCCAGAGGCTGCACCAGGCTGG + Intronic
934776472 2:96940950-96940972 GGCCACAGCCTGCACAAGGCAGG - Intronic
935216747 2:100980950-100980972 CCCAAGAGGCTGCACCCTGCTGG - Intronic
936523542 2:113227446-113227468 GGACAGAGGCTCCACCATGCAGG + Intronic
937054581 2:118922968-118922990 GGCCAGAGGCTGTGCCAGGTAGG - Intergenic
940096155 2:149978271-149978293 TGCCAGAGGGTGCACCAGAGGGG - Intergenic
941600913 2:167543737-167543759 GGTCAGAGGCTGCACCAAGATGG - Intergenic
942318932 2:174718922-174718944 CGACAGAGGCAGCAACATGCCGG - Intergenic
944148738 2:196534792-196534814 CTCCAGTGGCTTCACCTGGCAGG + Intronic
945212158 2:207394772-207394794 TGCCAGAGGCTGCTACAAGCTGG + Intergenic
945684379 2:212951675-212951697 GGCCAGTGGGTGCACCAGTCTGG + Intergenic
945789999 2:214293287-214293309 TGTCAGTGGCTGCAACAGGCTGG + Intronic
946416914 2:219544283-219544305 CGCCAGAGGCTCCAACTGACTGG - Exonic
946495443 2:220191861-220191883 CTGCAGTGGCTGCTCCAGGCAGG - Intergenic
948694309 2:239725523-239725545 CTCCTGAAGCTGCACCAGGGTGG - Intergenic
949039426 2:241840720-241840742 GACCTGAGGCTGCACCAGGCAGG - Intergenic
1168835156 20:872927-872949 TGCCAGAGGCTGGACCACACAGG - Exonic
1168907968 20:1422001-1422023 CCCCAGAGCCAGCACCAAGCAGG + Intergenic
1169140031 20:3222565-3222587 CACCAGAGGCTGCAAAAGCCTGG - Intronic
1169143688 20:3239349-3239371 CGCGGGAGGCTGCTCCAGCCGGG + Intergenic
1169205791 20:3739803-3739825 CGCCTTAGGCTGAGCCAGGCAGG - Intronic
1169697831 20:8410935-8410957 CACCAGAGGCTGAAAGAGGCAGG + Intronic
1171309445 20:24134795-24134817 CCCCAGTGGCTGCTCCAGGCTGG - Intergenic
1172379508 20:34476389-34476411 GGCCGGTGGCTGCACCACGCCGG - Intronic
1173230442 20:41192126-41192148 TGGCAGTGGCTGCAACAGGCTGG + Intronic
1174527381 20:51184417-51184439 AGCCATACCCTGCACCAGGCAGG + Intergenic
1174885286 20:54327571-54327593 CACCAGAAGCTGCAGGAGGCAGG - Intergenic
1175929179 20:62485566-62485588 CGCCAGAGGCAGCCGCAGACCGG + Intergenic
1178062883 21:28871791-28871813 TGCCAGAGGCTGGAAGAGGCAGG - Intergenic
1178514635 21:33236330-33236352 CCACAGAGCCTGCCCCAGGCTGG - Intronic
1179129036 21:38617965-38617987 TGCCAGGTGCTGCTCCAGGCTGG - Intronic
1180002956 21:45003322-45003344 AGGCAGAGATTGCACCAGGCAGG + Intergenic
1181682302 22:24503899-24503921 AACCAGGGGCTGCCCCAGGCTGG + Intronic
1181695891 22:24592687-24592709 CGCGACAGGCTGCAGCACGCGGG - Intronic
1181804093 22:25364792-25364814 CGCCCGAGCCTCCTCCAGGCGGG + Intronic
1182349450 22:29691043-29691065 GGACAGTGGCTGCACCAGTCTGG - Intronic
1182475546 22:30574659-30574681 CGCCGGAGGCTGGGCCAGGCTGG - Intergenic
1182745953 22:32605683-32605705 GTCCAGAGGCGGCACCATGCAGG - Intronic
1182861240 22:33561278-33561300 AACCAGGGGCTGCCCCAGGCTGG + Intronic
1183058957 22:35323680-35323702 CCCCAGAGACATCACCAGGCTGG + Intronic
1183367137 22:37412798-37412820 TGCCAGAGGCTGGACCTGGAGGG - Intronic
1184289503 22:43490832-43490854 CCCCACTGGCTGAACCAGGCAGG - Intronic
1184438989 22:44497539-44497561 CGTCTGCGGCTGCACCATGCTGG + Exonic
1184559231 22:45252072-45252094 CACCAGAAGCTGCAAGAGGCAGG - Intergenic
1184998810 22:48229180-48229202 CACCAGAGGCTGGAAGAGGCAGG + Intergenic
1185014117 22:48333550-48333572 CGTGAGAGGCTGCAGCAGGCGGG + Intergenic
1185045705 22:48527739-48527761 CGACAGAGGCTGACCCAGGAAGG - Intronic
1185055453 22:48576391-48576413 CCGCGGAGGCTGCACCCGGCGGG + Intronic
1185137194 22:49079737-49079759 GGCCAGAGGCTCCCCTAGGCAGG + Intergenic
1185139413 22:49092086-49092108 CACCAGAGGCTGGAAGAGGCAGG + Intergenic
1185308884 22:50141633-50141655 GGCAAGATCCTGCACCAGGCCGG - Intronic
1185312757 22:50165744-50165766 GCCCAGATGCTGCCCCAGGCAGG + Intergenic
1185359883 22:50399678-50399700 AGCCAGGGGCTGCTCCAGGGAGG + Intronic
952261866 3:31747939-31747961 CAGCAGAGTGTGCACCAGGCGGG - Exonic
953187380 3:40651517-40651539 TGCCAGAGGCTGCTTAAGGCAGG + Intergenic
953227122 3:41030914-41030936 CCCCAGGTCCTGCACCAGGCTGG + Intergenic
954307665 3:49738269-49738291 CGCCGGAGCCTGCACCGGTCAGG - Exonic
955227601 3:57073871-57073893 GGGCAGAGGCTGCTCCTGGCAGG - Exonic
955397461 3:58567203-58567225 CAGCAGAGGCTGAACCAGGTGGG - Exonic
958801851 3:98765122-98765144 CTCAAGAGTCTGCACCAGGCGGG - Intronic
961408866 3:126704163-126704185 CGCCAGAGGCTTCACCAATCGGG - Intergenic
961661615 3:128471686-128471708 GGGCAGGGGCTGCACAAGGCAGG + Intergenic
962849252 3:139295620-139295642 CTCCAGAGGCTTCTCCAGGCAGG - Intronic
966133743 3:176674563-176674585 GGCCAGGGGCTGGACAAGGCTGG - Intergenic
967904325 3:194487744-194487766 AGCCAGAGGCTGCAGGTGGCCGG - Intronic
968178079 3:196568681-196568703 CGCCAGCGGCTCCGCCATGCGGG - Exonic
968502852 4:959225-959247 CCCAGGAGGCTGCAGCAGGCTGG + Exonic
969056438 4:4405658-4405680 CTCCAGAGTCTGCACAGGGCAGG + Intronic
969505615 4:7585401-7585423 CCCCAGAGGCAGCCTCAGGCTGG - Intronic
969604827 4:8197217-8197239 CCCCAGAGGCTGGAGCAGGCAGG + Intronic
972990165 4:44814597-44814619 GGCCAGAGGCTGCAGCTGGGAGG + Intergenic
973647883 4:52968321-52968343 AGTCAGAGGCTGCATCAGGGAGG + Intronic
974472098 4:62331623-62331645 CCACAGAAGCTGCAGCAGGCAGG + Intergenic
977765465 4:100792375-100792397 TGGCAGAGGCTTCACCAGGCGGG - Intronic
977926522 4:102705957-102705979 TGACAGTGGCTGCAACAGGCTGG - Intronic
982232590 4:153222828-153222850 CGCCTGAGGCTGCAGAAGGGCGG + Intronic
985524863 5:396692-396714 GGCCAGAGGTTTCACCAGGGAGG + Intronic
985839969 5:2298748-2298770 CCCCAGAGGGTGGACAAGGCAGG + Intergenic
986216498 5:5724395-5724417 CCCCAGATGCTGCAGCAGGCTGG - Intergenic
986285156 5:6353815-6353837 CTCAAGAGGCTTCACCAGGAAGG + Intergenic
986719294 5:10549633-10549655 CACCAGAGGCTGGAGGAGGCAGG - Intergenic
987537581 5:19208450-19208472 TGGCAGGGGCTGCTCCAGGCAGG - Intergenic
987848792 5:23322748-23322770 CACCAGGGCCTGCAACAGGCTGG + Intergenic
989188472 5:38646924-38646946 GGCCCCAGGCTGCCCCAGGCAGG + Intergenic
991926461 5:71709970-71709992 CCTCAGAGGCCTCACCAGGCTGG + Intergenic
994043407 5:95283940-95283962 CTCCAGCAGCTGCTCCAGGCAGG + Exonic
997267051 5:132501080-132501102 AGCCACAGGCTGCCCCAGGAAGG + Intergenic
998174767 5:139894974-139894996 AGGCAGAAGCTGCACCAGGAGGG + Intronic
1001061801 5:168496990-168497012 TACTAGAGGCTGCACAAGGCAGG - Intronic
1001504546 5:172266930-172266952 CCCCAGAGGCTGCCTGAGGCAGG + Intronic
1001586182 5:172834909-172834931 AGCCTGAGGCTCCCCCAGGCCGG + Intronic
1002195213 5:177497485-177497507 CGTCTTGGGCTGCACCAGGCGGG - Intronic
1002576135 5:180175199-180175221 CCCCAGAGGCTAGGCCAGGCTGG - Intronic
1003145320 6:3505407-3505429 AGCCACAGGCTCCTCCAGGCTGG + Intergenic
1003868471 6:10383590-10383612 GCCCAGAGGCTGCACCACCCAGG + Intergenic
1008563747 6:52747555-52747577 CGCCAGAAGCTGTAAGAGGCAGG + Intergenic
1009940414 6:70282658-70282680 CGCCAGAGCCTGCAGTAGGGAGG + Intronic
1010710948 6:79173578-79173600 CACCAGATGCTGCAAGAGGCAGG + Intergenic
1011441599 6:87392794-87392816 CAGGAGAGGCTGCAACAGGCTGG + Exonic
1011674480 6:89718848-89718870 TGCCAGAAGCTGGACCAGGCTGG + Exonic
1017771147 6:157645508-157645530 CCACAGAGGCTGCTCCACGCCGG + Intronic
1018610520 6:165643676-165643698 CACCAGAGGCTGGGACAGGCAGG + Intronic
1018947570 6:168357620-168357642 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947588 6:168357674-168357696 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947760 6:168358224-168358246 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947778 6:168358278-168358300 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947965 6:168358883-168358905 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947983 6:168358937-168358959 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1019070363 6:169340557-169340579 AGCCAGTGGCTGCACAAGGCAGG - Intergenic
1019715605 7:2537957-2537979 CCCCAGAGGATCCACCGGGCTGG + Exonic
1019772252 7:2891058-2891080 CGCCAGAGACTGGAAGAGGCAGG - Intergenic
1025777368 7:64570545-64570567 CGCCTGCGGCTGCACCGGCCCGG + Intergenic
1025929513 7:65982591-65982613 TGCAAGAGGCTGCATCAGACAGG - Intergenic
1025958370 7:66199916-66199938 GGCCAGAGGTTTCACCATGCTGG + Intergenic
1029367737 7:100127378-100127400 CGCATGAGGCTGCTCCTGGCAGG - Exonic
1030305922 7:108018804-108018826 TCCCAGAGCCAGCACCAGGCAGG - Intergenic
1030362008 7:108605165-108605187 AACCAGGGGCTGCCCCAGGCTGG + Intergenic
1031499292 7:122492536-122492558 CGTCAGATGCTACAACAGGCAGG + Intronic
1032578446 7:133081306-133081328 AGCCAGAAGCCGCCCCAGGCAGG + Intronic
1033683259 7:143617234-143617256 TGCCAGGGGCTTCTCCAGGCTGG - Intergenic
1033701354 7:143840404-143840426 TGCCAGGGGCTTCTCCAGGCTGG + Intergenic
1035321267 7:158030693-158030715 CACCAGAGGCTGGAGGAGGCAGG + Intronic
1035331122 7:158098175-158098197 AGGCAGAGGCTGCCCCACGCTGG - Intronic
1036362053 8:8084868-8084890 CGCCAGAGCCAGAGCCAGGCTGG - Intergenic
1036504054 8:9339302-9339324 GGCCAGAGGCTGAACCATTCGGG - Intergenic
1036888915 8:12582162-12582184 CGCCAGAGCCAGAGCCAGGCTGG + Intergenic
1036896496 8:12640304-12640326 CGCCAGAGCCAGAGCCAGGCTGG + Intergenic
1038134712 8:24772856-24772878 AGCCAGAGGCTGCACCTGCTGGG + Intergenic
1039079648 8:33722406-33722428 CGCCAGAGGCTGCCCATAGCAGG + Intergenic
1041152460 8:54950090-54950112 GGCCAGAGGATGCACCCGCCTGG + Intergenic
1045111885 8:98944430-98944452 CTCCCCAGGCTGCCCCAGGCCGG - Exonic
1045872221 8:106939886-106939908 AGCCACAGGCTGCAGCAGGCAGG - Intergenic
1048307672 8:133295464-133295486 CGGCAGAGCCAGCCCCAGGCTGG - Intronic
1048455627 8:134575674-134575696 CTCCAGAGGCAGGCCCAGGCTGG - Intronic
1048798263 8:138171654-138171676 CGGCTGAGGCTGCAGCAGGAAGG + Intronic
1048949136 8:139478621-139478643 CACCAAAAGCTGCTCCAGGCAGG - Intergenic
1049003652 8:139841544-139841566 GGCCAGAGCCTGCACTCGGCAGG - Intronic
1049409329 8:142465385-142465407 GGCCAGAGGCTGCAGCGGCCTGG + Intronic
1049463016 8:142738856-142738878 CGCCAGGGGCTCAACGAGGCAGG + Intergenic
1049675342 8:143886607-143886629 CACCAGGGCCTGTACCAGGCAGG + Intergenic
1057045809 9:91885511-91885533 CGCCTGGGCCTGCACCAGGGTGG + Intronic
1058818589 9:108708560-108708582 CGCCAGGGACTGGAACAGGCTGG - Intergenic
1059053404 9:110953037-110953059 TGACAGTGGCTGCAACAGGCTGG - Intronic
1060406052 9:123373618-123373640 CGCCAGGGGCCGCGCCGGGCCGG - Exonic
1061001171 9:127903817-127903839 CGCTGGGGGCTGCACCAGGAGGG + Intronic
1061062973 9:128259988-128260010 GGCCAGAGGCAGCTCCAGCCTGG - Intronic
1061129750 9:128702444-128702466 CTCCACCGGCTGCACCCGGCTGG + Intergenic
1061147092 9:128806377-128806399 CGCCAGCTGCTGCGACAGGCTGG + Intronic
1061450922 9:130666623-130666645 CTCCGCAGGCAGCACCAGGCTGG - Exonic
1061478955 9:130887012-130887034 TCCCCGAGGCTGCCCCAGGCCGG + Intronic
1061850211 9:133410512-133410534 AACCAGGGGCTGCCCCAGGCGGG + Intronic
1062158617 9:135067621-135067643 CTCCAGAAGCTGCAGGAGGCAGG + Intergenic
1062528248 9:136987232-136987254 CCCCAGAGGCTGCCCCACCCTGG - Intergenic
1185541450 X:905921-905943 GGGCAGAGGCTGCACCGGGAAGG + Intergenic
1188941389 X:36241807-36241829 GGGCAGAGGCTGCAGCAGGCAGG - Intronic
1190056044 X:47181568-47181590 TGCCAGGAGCAGCACCAGGCTGG - Exonic
1190924994 X:54894849-54894871 TGGCAGTGGCTGCAACAGGCTGG - Intergenic
1192177519 X:68895195-68895217 CGCCTGAGCCTGCACCCGCCTGG - Intergenic
1194113932 X:89873117-89873139 CTGAAGAGGCTGGACCAGGCAGG + Intergenic
1195389150 X:104342933-104342955 AGCCAGAGGCTGAAGCTGGCAGG + Intergenic
1198296850 X:135295680-135295702 CCCCAAAGGCTGCAACTGGCAGG + Intronic
1199686939 X:150273316-150273338 GGCCAGAGGCTGCACACAGCAGG - Intergenic
1200064835 X:153499386-153499408 CGCCACAGGCTGCAAAGGGCTGG + Intronic
1200079995 X:153571577-153571599 AGCAAGAGGCTGCCCCAGGGAGG - Intronic
1200466671 Y:3528473-3528495 CTGAAGAGGCTGGACCAGGCAGG + Intergenic
1201645690 Y:16228730-16228752 CGGCAGAGGCTGCACTGAGCAGG - Intergenic
1201657123 Y:16356586-16356608 CGGCAGAGGCTGCACTGAGCAGG + Intergenic