ID: 934763524

View in Genome Browser
Species Human (GRCh38)
Location 2:96868779-96868801
Sequence GCGGCGCGTTGCCAGCGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934763524 Original CRISPR GCGGCGCGTTGCCAGCGGCC CGG (reversed) Intronic
900097961 1:947993-948015 GGGGCGCGTTGCCAGCAGTCAGG + Intronic
902526365 1:17060447-17060469 GCGGCGAGATGCCAGCCGACTGG + Intergenic
903016866 1:20367021-20367043 GCGACCCGCTGCCAGGGGCCGGG + Intergenic
904673115 1:32180525-32180547 GCTCTGCGTTGCCAGCGGGCAGG + Intronic
914919705 1:151838786-151838808 GCGGCGCAGTGCCCGCGGCCCGG - Exonic
920678603 1:208056146-208056168 GCAGCGGGTTGCCAGGGTCCGGG - Intronic
922518192 1:226223722-226223744 GCGCCGCGTTTCCAGCGTACCGG + Exonic
922586714 1:226738800-226738822 GCGGCGCGGAGTGAGCGGCCCGG + Intronic
923372654 1:233328331-233328353 GCGGCGCGGGGCTGGCGGCCGGG - Exonic
1064443121 10:15371104-15371126 GCGGCGCGTCACGGGCGGCCGGG + Intergenic
1069019128 10:63465945-63465967 GCGGCGCGGTGGCGGCGGCTGGG - Intergenic
1069024012 10:63521253-63521275 GCGGCGCGTTGGCCCGGGCCAGG - Intergenic
1073156826 10:101354108-101354130 GCGCTGCGTTGGCTGCGGCCTGG + Exonic
1073491555 10:103855905-103855927 CCAGCGCGCAGCCAGCGGCCTGG + Intergenic
1075716336 10:124557918-124557940 GGGGTGCGTTGCCTGCAGCCTGG + Intronic
1076752098 10:132548379-132548401 GCTGCCCGTTGCCGGTGGCCCGG + Intronic
1079407194 11:20157181-20157203 CCCGCGCGCGGCCAGCGGCCAGG + Exonic
1081863492 11:46347407-46347429 GCGGCGGGCAGGCAGCGGCCCGG + Intronic
1089494859 11:118902788-118902810 GCGGGGCACTGCCAGGGGCCGGG + Exonic
1090224700 11:125063142-125063164 GCGCTGTGGTGCCAGCGGCCGGG + Intronic
1091567804 12:1661593-1661615 GTGGCGCGGTGACAGGGGCCCGG - Intergenic
1092108928 12:5945360-5945382 GCTGCGCGGCGCCGGCGGCCGGG - Intronic
1101640112 12:106581567-106581589 GCCGCGCGCTGCCAGGGGCCCGG + Intronic
1105378054 13:19863175-19863197 GGGGCGGGTTGCCGGCCGCCCGG - Intronic
1113796250 13:113060482-113060504 GGGGCGCGCAGCTAGCGGCCAGG - Intronic
1122509829 14:102257341-102257363 GCAGAGCGTTGTCAGCGGCAGGG + Intronic
1122532464 14:102438128-102438150 GCAGCGCGTTGCCGGGCGCCGGG + Exonic
1128454126 15:67823234-67823256 GCCGCGCGTGGCCCGCGGGCGGG + Intronic
1129672405 15:77614547-77614569 GCGGCGGGTCGCCATCGGCCCGG + Exonic
1130967091 15:88705536-88705558 GGGTCCCGCTGCCAGCGGCCGGG - Intergenic
1132110833 15:99100670-99100692 GCGGCGCTGCCCCAGCGGCCGGG + Intronic
1132646782 16:1002922-1002944 GCGACGCGATGCCGGTGGCCTGG - Intergenic
1133296080 16:4752959-4752981 TCGGCACGATGCCAGGGGCCTGG - Exonic
1136913989 16:34163883-34163905 GCCGCGCGGTGCCTGGGGCCCGG + Intergenic
1138360763 16:56425475-56425497 GCGGAGCGGCGCCAGCAGCCAGG - Exonic
1145077316 17:19867129-19867151 GCGGAGCGCTGCCAGAGGCTTGG + Intronic
1147994874 17:44354935-44354957 GCCGCGCTCTGCCAGCCGCCCGG - Exonic
1152377402 17:79925793-79925815 GCTGCGCGGAGCCAGCGTCCAGG - Intergenic
1160846129 19:1166916-1166938 GCCAAGCGTTGCCAGCAGCCGGG + Intronic
1162746580 19:12801957-12801979 GAGACGCGTTGCCTTCGGCCGGG + Intronic
1165961662 19:39539903-39539925 GAGGCCCGGTGCCGGCGGCCAGG - Exonic
1168240575 19:55086938-55086960 GCGGAGCGTTCCGATCGGCCGGG + Intronic
1168244308 19:55103474-55103496 GGGGCGCCATGCCAGAGGCCCGG - Exonic
1168544564 19:57240147-57240169 GCGGCGCGATGCCTCAGGCCTGG - Intergenic
931107010 2:59067210-59067232 GCGGCGCGTAGCCCACGGCGGGG - Intergenic
932599322 2:73112939-73112961 GCGGCCCGCGGCCAGCGGCCCGG - Exonic
934763524 2:96868779-96868801 GCGGCGCGTTGCCAGCGGCCCGG - Intronic
934846366 2:97663698-97663720 CCGGGGCGAAGCCAGCGGCCCGG + Intronic
935255787 2:101308555-101308577 GCGGCGCGAAGCCAGCGTCGGGG - Exonic
940300831 2:152175414-152175436 TCGGCGCGTCGCTAGCGGTCTGG - Intronic
940650435 2:156435952-156435974 GCCCCGCCTTGCCAGCGGGCTGG - Intronic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
948487358 2:238289217-238289239 GAGGCGCGCCCCCAGCGGCCAGG + Intronic
948626957 2:239275270-239275292 GCAGCGCTTTGCCGGCAGCCTGG - Intronic
1171908897 20:30922453-30922475 GCCGCGCGGTGCCTGGGGCCCGG + Intergenic
1173672893 20:44810370-44810392 GCGGCGTGGTGGCGGCGGCCCGG + Intergenic
1174204251 20:48827773-48827795 GCGCCGCGGCGCCAGGGGCCCGG + Exonic
1176548969 21:8213426-8213448 GCGGCGCGTCGGCCGGGGCCGGG + Intergenic
1176556862 21:8257638-8257660 GCGGCGCGTCGGCCGGGGCCGGG + Intergenic
1176567898 21:8396456-8396478 GCGGCGCGTCGGCCGGGGCCGGG + Intergenic
1176575802 21:8440675-8440697 GCGGCGCGTCGGCCGGGGCCGGG + Intergenic
1179810474 21:43865954-43865976 GCGGCGCGTTTGCACCGGGCGGG + Intronic
1181024002 22:20117469-20117491 GCGGCGCGTTTCCCGCCGCTGGG + Intronic
1183293991 22:37019371-37019393 GCGGGGCGGGGGCAGCGGCCGGG - Exonic
1184002941 22:41688621-41688643 GCGGCGGGGTCCCAGCAGCCTGG - Intronic
1203253853 22_KI270733v1_random:129733-129755 GCGGCGCGTCGGCCGGGGCCGGG + Intergenic
1203261909 22_KI270733v1_random:174812-174834 GCGGCGCGTCGGCCGGGGCCGGG + Intergenic
954763975 3:52897564-52897586 GCGGCGCGGAGTCGGCGGCCGGG - Exonic
956174401 3:66459404-66459426 GGGGTGCGTGGCCAGAGGCCAGG - Intronic
958719078 3:97822419-97822441 GCGGCCCGCTGCCGGCGGTCAGG - Intronic
988949509 5:36242318-36242340 GCGGCGCGGGGCCAGCGGGTGGG + Intergenic
997965373 5:138352537-138352559 GCGGAGCGCTGCGAGGGGCCAGG + Intergenic
1002193809 5:177491817-177491839 GCGGGGCGCTGTCAGCGGGCGGG + Exonic
1003552363 6:7109565-7109587 GCGGCGCCTGTCAAGCGGCCCGG - Intronic
1011277456 6:85643813-85643835 GCGGGGCGGTGGCAGCGGCGTGG - Intergenic
1015024928 6:128520736-128520758 GCGGCGCGGGGCGCGCGGCCGGG - Intergenic
1016328228 6:142927014-142927036 GCGGCGCGGGGCGGGCGGCCAGG + Intronic
1017021298 6:150142709-150142731 GCGGCGCGTTTCCTGCGCTCCGG + Intergenic
1019769781 7:2876448-2876470 GCGGGGCGCTGCCTGAGGCCCGG + Intergenic
1022101039 7:27169334-27169356 GCAGCGCTTTGCCAGCCGGCCGG - Intronic
1023737714 7:43249157-43249179 GCGGAGCCTTGGCTGCGGCCCGG + Intronic
1034441211 7:151086851-151086873 GCGGCGCGGGGCCCGGGGCCGGG + Exonic
1036803266 8:11808601-11808623 GCGGGGCGGTGCCTGCGCCCGGG - Intronic
1037273864 8:17156954-17156976 GCGGCAGGTTGGCAGCGCCCGGG - Intronic
1037589931 8:20303919-20303941 CTGGCGGGTTGGCAGCGGCCGGG - Exonic
1037826834 8:22164956-22164978 GCGGCCCGCGGCCCGCGGCCCGG + Exonic
1053482315 9:38424566-38424588 CCCGCGCGGTGCCCGCGGCCCGG + Intergenic
1057432318 9:95005231-95005253 GCGGCGCGGTCCCTGCGCCCCGG + Intronic
1061293656 9:129666022-129666044 GGGGCGCGCCGCCAGCCGCCCGG - Exonic
1062653455 9:137590186-137590208 GCGGCGCGGAGCCCGCGACCCGG - Intronic
1203470253 Un_GL000220v1:112877-112899 GCGGCGCGTCGGCCGGGGCCGGG + Intergenic
1203478074 Un_GL000220v1:156849-156871 GCGGCGCGTCGGCCGGGGCCGGG + Intergenic
1187669541 X:21655950-21655972 GCTGCGCGTTGCCCTGGGCCTGG - Exonic
1189318684 X:40074185-40074207 GCAGCGAGTTCCCCGCGGCCAGG - Exonic
1197962693 X:132023450-132023472 GCGGCGCGTAGCCCGGGGCTAGG - Intergenic