ID: 934763891

View in Genome Browser
Species Human (GRCh38)
Location 2:96869898-96869920
Sequence CCGGGCGCCGCCCTCGCGTT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 38}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934763883_934763891 9 Left 934763883 2:96869866-96869888 CCTCGCTCACCTATTGCGCGCAG 0: 1
1: 0
2: 0
3: 0
4: 14
Right 934763891 2:96869898-96869920 CCGGGCGCCGCCCTCGCGTTCGG 0: 1
1: 0
2: 1
3: 5
4: 38
934763884_934763891 0 Left 934763884 2:96869875-96869897 CCTATTGCGCGCAGCTCCAGTCC 0: 1
1: 0
2: 0
3: 1
4: 43
Right 934763891 2:96869898-96869920 CCGGGCGCCGCCCTCGCGTTCGG 0: 1
1: 0
2: 1
3: 5
4: 38
934763880_934763891 25 Left 934763880 2:96869850-96869872 CCTCACGCAAGCCCGGCCTCGCT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 934763891 2:96869898-96869920 CCGGGCGCCGCCCTCGCGTTCGG 0: 1
1: 0
2: 1
3: 5
4: 38
934763881_934763891 14 Left 934763881 2:96869861-96869883 CCCGGCCTCGCTCACCTATTGCG 0: 1
1: 0
2: 1
3: 5
4: 56
Right 934763891 2:96869898-96869920 CCGGGCGCCGCCCTCGCGTTCGG 0: 1
1: 0
2: 1
3: 5
4: 38
934763882_934763891 13 Left 934763882 2:96869862-96869884 CCGGCCTCGCTCACCTATTGCGC 0: 1
1: 0
2: 0
3: 1
4: 64
Right 934763891 2:96869898-96869920 CCGGGCGCCGCCCTCGCGTTCGG 0: 1
1: 0
2: 1
3: 5
4: 38
934763879_934763891 29 Left 934763879 2:96869846-96869868 CCAGCCTCACGCAAGCCCGGCCT 0: 1
1: 0
2: 1
3: 10
4: 160
Right 934763891 2:96869898-96869920 CCGGGCGCCGCCCTCGCGTTCGG 0: 1
1: 0
2: 1
3: 5
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934763891 Original CRISPR CCGGGCGCCGCCCTCGCGTT CGG Exonic
908128736 1:61053978-61054000 CCGGGCGCCGCCCTCTGGCTCGG - Intronic
914250496 1:145918220-145918242 CCTGCCTCCGCCCTGGCGTTTGG - Intronic
1079203708 11:18395909-18395931 CCGTGCGCCTCCCTCCCGGTTGG + Intronic
1085025981 11:73236880-73236902 CAGGGCCCCGCCCTAGCCTTTGG + Intergenic
1096773958 12:53953068-53953090 CCAGGAGCCGGCCCCGCGTTAGG - Intergenic
1113962269 13:114132626-114132648 CCGGTCCCCGCCCTCGCCCTCGG - Intergenic
1119438144 14:74611452-74611474 CCGTGAGCCGCCCTCGCGGCGGG + Exonic
1124576340 15:30912287-30912309 CCAGGCGCTGCCCTAGCGTGGGG - Intronic
1128743946 15:70100754-70100776 CCGGGCTCGGCCCTGGCGCTGGG - Intergenic
1144756083 17:17681531-17681553 CCGGGCGCCGCCCCCGCCCGCGG + Exonic
1148685163 17:49496763-49496785 CCGGGCGCCCCCGTCTCGTTAGG - Intronic
1152682126 17:81673980-81674002 GCGGCCCCAGCCCTCGCGTTGGG + Intergenic
1162959464 19:14117543-14117565 CCGGCCGCCGCCGCCGCGATGGG - Exonic
1164834492 19:31349041-31349063 CCGGGCGCCGCTCTCCTGTTTGG - Intronic
925285563 2:2713526-2713548 CCGGGCGCTGCCCTTGTGTTGGG + Intergenic
929452624 2:42047662-42047684 CCGTTATCCGCCCTCGCGTTGGG + Intergenic
934763891 2:96869898-96869920 CCGGGCGCCGCCCTCGCGTTCGG + Exonic
943618445 2:190120044-190120066 CCGTCCGCGGCCCTCGGGTTGGG - Intronic
946310624 2:218880795-218880817 CCGGGCACCGCCCTCGGGGGGGG - Exonic
946382418 2:219358264-219358286 CCCAGCTCCGCCCTCGCCTTTGG - Intergenic
948393477 2:237628040-237628062 CCGGGCGCCGCCAGCGCGCGAGG + Intronic
1172277081 20:33685829-33685851 CCGGGCCCCGCCCTGGGGTGCGG - Intronic
1182552506 22:31107707-31107729 CCTGGCTCCTCCCTGGCGTTTGG + Exonic
1182712722 22:32332597-32332619 CCGGAGGCTGCCCTGGCGTTGGG + Intergenic
1185409618 22:50674846-50674868 CGGGGCCCCGCCCTGGCGATGGG - Intergenic
952430554 3:33219049-33219071 CCCGGCTCCGCCTTCGCGCTGGG + Exonic
956109484 3:65856218-65856240 CCAGGCATCGCCCTCGGGTTGGG + Intronic
956468508 3:69542099-69542121 CCGGGCGCAGCGCGCACGTTTGG - Intronic
963116989 3:141738556-141738578 CCGGGAGCCGACCTCGGGGTTGG + Intronic
968008702 3:195259699-195259721 CCGGGGGCCGCCCTGGTGCTGGG - Intronic
993905779 5:93621440-93621462 CCGGGCCGCGTCCCCGCGTTGGG - Intronic
994497761 5:100535410-100535432 CCGGGCCTCTCCCTGGCGTTTGG + Exonic
1001506435 5:172283900-172283922 CCGCGCGCCGCCCTCGCCTTCGG + Exonic
1002162099 5:177320443-177320465 CCGAGCACCGCCCTCAGGTTGGG - Intergenic
1002180176 5:177427104-177427126 CAGGCCGCCGCCCTCGCGGCGGG + Intronic
1002638368 5:180619121-180619143 CCGGGCGGCGGCCGTGCGTTCGG + Intronic
1005040211 6:21594598-21594620 TCGGGCGCCGGCCTCGAGCTGGG + Exonic
1007636402 6:43302369-43302391 CTGGGCACGGCCCTGGCGTTCGG + Exonic
1019343756 7:519998-520020 CCGGGCGCCGCCGCCGCGGCAGG + Intronic
1034470449 7:151251879-151251901 CCGGCCGCCGCCCGCTCGCTCGG - Intronic
1039886004 8:41654171-41654193 CCCGGCCCCGCCCTCGCGGCGGG - Intronic
1049987987 9:970173-970195 CCGGGCCCCGCCCTCCCGCTGGG - Intergenic
1053149201 9:35732199-35732221 CAGGGCGCCGCCCGCGGGTGGGG - Exonic
1062579214 9:137222121-137222143 CCGGGCCCCGCCATCGCCTGAGG - Intergenic
1186670071 X:11758573-11758595 CCGGGCGGCGCACGCGCGGTTGG + Intronic