ID: 934763982

View in Genome Browser
Species Human (GRCh38)
Location 2:96870185-96870207
Sequence GCGGGTCCACAGGTCGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 86}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934763982_934763989 -5 Left 934763982 2:96870185-96870207 CCCGCAGCGACCTGTGGACCCGC 0: 1
1: 0
2: 2
3: 7
4: 86
Right 934763989 2:96870203-96870225 CCCGCCCGCTCTCCGCCCGGGGG 0: 1
1: 0
2: 4
3: 30
4: 201
934763982_934763998 17 Left 934763982 2:96870185-96870207 CCCGCAGCGACCTGTGGACCCGC 0: 1
1: 0
2: 2
3: 7
4: 86
Right 934763998 2:96870225-96870247 GCTCGGACCTCCGCCTCTCTGGG 0: 1
1: 0
2: 0
3: 8
4: 89
934763982_934763985 -8 Left 934763982 2:96870185-96870207 CCCGCAGCGACCTGTGGACCCGC 0: 1
1: 0
2: 2
3: 7
4: 86
Right 934763985 2:96870200-96870222 GGACCCGCCCGCTCTCCGCCCGG 0: 1
1: 0
2: 1
3: 14
4: 132
934763982_934763986 -7 Left 934763982 2:96870185-96870207 CCCGCAGCGACCTGTGGACCCGC 0: 1
1: 0
2: 2
3: 7
4: 86
Right 934763986 2:96870201-96870223 GACCCGCCCGCTCTCCGCCCGGG 0: 1
1: 1
2: 0
3: 24
4: 146
934763982_934763987 -6 Left 934763982 2:96870185-96870207 CCCGCAGCGACCTGTGGACCCGC 0: 1
1: 0
2: 2
3: 7
4: 86
Right 934763987 2:96870202-96870224 ACCCGCCCGCTCTCCGCCCGGGG 0: 1
1: 1
2: 1
3: 15
4: 130
934763982_934764000 24 Left 934763982 2:96870185-96870207 CCCGCAGCGACCTGTGGACCCGC 0: 1
1: 0
2: 2
3: 7
4: 86
Right 934764000 2:96870232-96870254 CCTCCGCCTCTCTGGGTGCCCGG 0: 1
1: 0
2: 13
3: 137
4: 2870
934763982_934763997 16 Left 934763982 2:96870185-96870207 CCCGCAGCGACCTGTGGACCCGC 0: 1
1: 0
2: 2
3: 7
4: 86
Right 934763997 2:96870224-96870246 GGCTCGGACCTCCGCCTCTCTGG 0: 1
1: 0
2: 2
3: 17
4: 305
934763982_934763993 0 Left 934763982 2:96870185-96870207 CCCGCAGCGACCTGTGGACCCGC 0: 1
1: 0
2: 2
3: 7
4: 86
Right 934763993 2:96870208-96870230 CCGCTCTCCGCCCGGGGGCTCGG 0: 1
1: 0
2: 0
3: 13
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934763982 Original CRISPR GCGGGTCCACAGGTCGCTGC GGG (reversed) Intronic
900119831 1:1043816-1043838 GCATCTCCACAGGTCTCTGCAGG - Exonic
900626591 1:3611384-3611406 GCGGAGCCCAAGGTCGCTGCAGG + Exonic
900666425 1:3818317-3818339 GCCGGTAGACAGGTGGCTGCAGG - Intronic
906128773 1:43443445-43443467 GGGGGTCCAGAGGTCTCTGGGGG - Exonic
922215304 1:223515468-223515490 CCTGGCCCACAGGTCCCTGCTGG - Intergenic
1069833164 10:71293439-71293461 GTGGGTCCACAGGTCACCGAGGG - Exonic
1075910974 10:126125629-126125651 GAGAGTCCCCAGGTCACTGCAGG + Intronic
1077177189 11:1196273-1196295 CCAGGCCCACAGGTGGCTGCGGG + Intronic
1077518115 11:3014477-3014499 GCGTGTCCACAGCACGCTGAAGG + Intronic
1077529382 11:3088046-3088068 CCGGGGCCACAAGGCGCTGCGGG - Exonic
1083266016 11:61547086-61547108 GCGGGTCCAGAGGTGGGTGGGGG + Intronic
1084399781 11:68936866-68936888 GCTGGGCCACCGGTCCCTGCTGG - Exonic
1091252682 11:134156667-134156689 CCGGGTGCACTGGGCGCTGCTGG - Intronic
1095983710 12:47986433-47986455 GCTGGTCCTCAGGGCCCTGCTGG - Exonic
1097156181 12:57013830-57013852 GTTGGTCCACAGGTCACTCCTGG - Intronic
1099969921 12:89490038-89490060 GCTGGTACCCAGGTCCCTGCCGG - Intronic
1101728505 12:107407486-107407508 GCGTGTCCCCTGGTAGCTGCTGG - Intronic
1109897169 13:68708550-68708572 GCGGGTCCTCAGTCCGCTGCGGG - Intergenic
1111949912 13:94702253-94702275 GCGGGCCTACAGGCGGCTGCGGG - Intergenic
1112183844 13:97110015-97110037 GCAGGTCCCCTGGGCGCTGCCGG + Intergenic
1113231616 13:108218491-108218513 GTGGGGCCACAGCTCGCAGCAGG + Exonic
1123999406 15:25742269-25742291 ACAGGTCCACAGGTGGCTTCTGG + Intronic
1131456219 15:92584653-92584675 GCTGGTCCCCAGGTCTGTGCAGG - Intergenic
1132577786 16:671914-671936 TCGGGGCCCCAGGGCGCTGCTGG - Exonic
1132806220 16:1776310-1776332 GAGGGTCCACATGTGGCTGGGGG - Exonic
1135696911 16:24596327-24596349 GCGTGATCACAGGTCACTGCAGG - Intergenic
1138577960 16:57920580-57920602 GGGGGTGCACAGGTCCCTCCCGG - Intronic
1140263713 16:73402563-73402585 GCGGGTCCACAGGTCGTTCCTGG - Intergenic
1142011569 16:87717998-87718020 ACGGGTCCACAGGTTCCTTCCGG + Intronic
1142149097 16:88504915-88504937 GAGGGCCCCCAGGTCCCTGCAGG + Intronic
1142518843 17:491307-491329 GCGGCTCCCCAGGCCTCTGCGGG - Intergenic
1145776348 17:27531682-27531704 GCAGCTCCTCAGGGCGCTGCTGG - Intronic
1147959021 17:44154866-44154888 GACGGTGCACAGGTTGCTGCTGG + Exonic
1150703774 17:67469617-67469639 GCGGGTCATCAGGGCCCTGCTGG + Intronic
1152104137 17:78319023-78319045 GCGGGTCCACATCTGGCTGAGGG - Intergenic
1152736640 17:82000478-82000500 CCGGGGCCACATGCCGCTGCTGG + Intronic
1152911074 17:83005066-83005088 GCAGGTGCACAGGTCGCCTCTGG - Intronic
1156350524 18:36297967-36297989 GGGGGTCCATAGGCTGCTGCAGG + Exonic
1157570725 18:48710332-48710354 GCGCATGCTCAGGTCGCTGCAGG + Intronic
1160529531 18:79555388-79555410 GCGGGTCCAGAAGTCGCCCCCGG - Intergenic
1160849140 19:1181705-1181727 GGGTGTCCTCAGGTCGGTGCTGG + Intronic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1163518659 19:17779491-17779513 GCAGGTGGAAAGGTCGCTGCAGG + Intronic
1163686637 19:18715619-18715641 CCGGGGCCACAGGTGGCTGAGGG - Intronic
1165069951 19:33249340-33249362 GCGGGTGCCCAGGAGGCTGCGGG + Intergenic
1167220363 19:48195212-48195234 GCGGACCCACATGTCGCGGCGGG - Exonic
1167663248 19:50808699-50808721 GCAGGCCCACAGGTACCTGCAGG - Intergenic
925928187 2:8685409-8685431 GCGGGTCCGCAGGGCGATCCGGG - Intergenic
927148820 2:20184199-20184221 GCGGGACCACAGGTGGCAGAGGG + Intergenic
934572842 2:95383311-95383333 GCTGGGCCACAGTTCTCTGCAGG + Intronic
934763982 2:96870185-96870207 GCGGGTCCACAGGTCGCTGCGGG - Intronic
934765898 2:96879827-96879849 GGGCGTCCACAGGCCGCTGCAGG - Intronic
935059341 2:99593946-99593968 GCGGGCGCACAGGGCACTGCGGG + Exonic
935371850 2:102355882-102355904 CGGGGTCCAAAGGTTGCTGCTGG - Intronic
947645072 2:231732803-231732825 GCTGGTCCCCTGGTGGCTGCAGG + Exonic
1168802350 20:651725-651747 GTGGGCACACAGGTGGCTGCAGG + Intronic
1170554768 20:17506087-17506109 GAGGGTTCAGAGTTCGCTGCCGG + Intronic
1173190205 20:40870144-40870166 GTGGGTTCACAGGTTGATGCAGG - Intergenic
1178923542 21:36756531-36756553 CTGGGTCCACAGGTCAGTGCTGG - Exonic
1180488726 22:15822188-15822210 TCGGGTCCGCAGGTCACCGCGGG - Intergenic
1181268163 22:21642955-21642977 GCGGGTCCCCGGTGCGCTGCGGG + Exonic
952382659 3:32817166-32817188 GCGGGGCCGCAGGTCCCCGCGGG - Intergenic
953092856 3:39746961-39746983 GAGGGCCCAGAGGTCCCTGCGGG + Intergenic
954034933 3:47846365-47846387 GTGGGTCCACAGGTAGCTGGGGG - Exonic
967921445 3:194617228-194617250 CCGGGTCCACAGGTGGATGGAGG + Exonic
969360252 4:6658754-6658776 GCGGGCCCGCAGGGAGCTGCTGG + Intergenic
969362636 4:6674341-6674363 GCGGGCCCGCAGGAAGCTGCTGG + Intergenic
971351927 4:25862953-25862975 GCGGGTCCGGAGGTGGCGGCAGG - Exonic
984296055 4:177855984-177856006 GGGAGGCCACAGGTGGCTGCAGG - Intronic
985551131 5:534172-534194 GCAGGTCCACAGGGAGGTGCAGG + Intergenic
985989675 5:3545310-3545332 GCCTGTCCACAGGACACTGCAGG + Intergenic
986286992 5:6366472-6366494 GTGTGTGCATAGGTCGCTGCCGG - Intergenic
998139040 5:139689737-139689759 GTGGGTCCACAGGCAGCTGCTGG + Intergenic
1001513397 5:172338830-172338852 GTGGGACCACAGGTCTCTGCTGG + Exonic
1005549197 6:26897378-26897400 GCGGATCAACAGTGCGCTGCAGG + Intergenic
1007118529 6:39361723-39361745 GCTGGTCTTCAGGTCGCTCCTGG - Intronic
1007728840 6:43933388-43933410 GCGGCCCCACAGGTCTCTTCGGG - Intergenic
1009019941 6:57938488-57938510 GCGGATCAACAGTGCGCTGCAGG + Intergenic
1013599969 6:111694518-111694540 GGGTTTCCACAGGTGGCTGCAGG - Exonic
1015414254 6:132930858-132930880 GTGGGTACACAGGTCACTCCTGG - Intergenic
1017768029 6:157622987-157623009 GCAGGTCCACAGGTCACTGCAGG + Intronic
1020353714 7:7253741-7253763 ACGGGTCCACATGAGGCTGCTGG - Intergenic
1022715022 7:32891477-32891499 GCCCCTCCACAGGTCGCCGCGGG + Intronic
1029949468 7:104567843-104567865 GAGGGTCCACAGGTCAATGCAGG - Intronic
1034284167 7:149873625-149873647 GCGGGTCCGCAGGGCGCTTCGGG + Exonic
1034492072 7:151398834-151398856 GAGGGCCCACTGGTCACTGCAGG + Intronic
1034675228 7:152888069-152888091 TCGAGTTCACAGGTGGCTGCAGG - Intergenic
1037759779 8:21734108-21734130 GCCGGTCCACTGCACGCTGCAGG - Intronic
1040493086 8:47942665-47942687 GGGTGTCCAGAGGTGGCTGCAGG - Intronic
1042615518 8:70644531-70644553 GCAGGATCACAGGTCACTGCAGG + Intronic
1044854128 8:96457355-96457377 GTGGGTACAGAGATCGCTGCGGG - Intergenic
1053158615 9:35797528-35797550 GCGGGTCCACAGATAGAGGCAGG + Intronic
1057217576 9:93237950-93237972 GTGGGGCCACAGGGCTCTGCTGG + Intronic
1061432979 9:130543053-130543075 GCTGGTCCACAGGGCCCTGTGGG + Intergenic
1062288613 9:135784771-135784793 GCGGATCCACAGGTCGCCCTCGG - Exonic
1062402452 9:136378510-136378532 GCGGGGCCAGGGGTCCCTGCTGG + Exonic