ID: 934764094

View in Genome Browser
Species Human (GRCh38)
Location 2:96870557-96870579
Sequence CTAGAAAGAGGCAGAATTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 339}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934764094_934764108 18 Left 934764094 2:96870557-96870579 CCCCCAATTCTGCCTCTTTCTAG 0: 1
1: 0
2: 2
3: 29
4: 339
Right 934764108 2:96870598-96870620 CCCTGCCCTCAAGTCTGGAAAGG 0: 1
1: 0
2: 1
3: 22
4: 232
934764094_934764101 -6 Left 934764094 2:96870557-96870579 CCCCCAATTCTGCCTCTTTCTAG 0: 1
1: 0
2: 2
3: 29
4: 339
Right 934764101 2:96870574-96870596 TTCTAGGCCCCGAGGACCACTGG 0: 1
1: 0
2: 1
3: 3
4: 76
934764094_934764106 13 Left 934764094 2:96870557-96870579 CCCCCAATTCTGCCTCTTTCTAG 0: 1
1: 0
2: 2
3: 29
4: 339
Right 934764106 2:96870593-96870615 CTGGTCCCTGCCCTCAAGTCTGG 0: 1
1: 0
2: 4
3: 33
4: 373
934764094_934764110 19 Left 934764094 2:96870557-96870579 CCCCCAATTCTGCCTCTTTCTAG 0: 1
1: 0
2: 2
3: 29
4: 339
Right 934764110 2:96870599-96870621 CCTGCCCTCAAGTCTGGAAAGGG 0: 1
1: 0
2: 1
3: 14
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934764094 Original CRISPR CTAGAAAGAGGCAGAATTGG GGG (reversed) Intronic
900269870 1:1781551-1781573 CGGGCAAGAAGCAGAATTGGTGG + Intergenic
900332566 1:2143430-2143452 CTGGAAAGAATCTGAATTGGAGG + Intronic
902125653 1:14208773-14208795 CTAGAGATAGGTAGAAGTGGAGG + Intergenic
902456360 1:16536439-16536461 CTCGGAAGAGGCCGATTTGGAGG - Intergenic
902495804 1:16871472-16871494 CTCGGAAGAGGCTGATTTGGAGG + Intronic
902646927 1:17806052-17806074 CTAGAAAGAGGAGGAAAAGGAGG - Intronic
903504610 1:23824743-23824765 CTAGAAAGTGGCAGAACTATTGG + Intronic
903694763 1:25198564-25198586 AAAGAGAGAGGCAGAATTGAGGG + Intergenic
903946913 1:26969805-26969827 TGAGAAAGGGGAAGAATTGGAGG - Intergenic
904410767 1:30323561-30323583 TTGGAATGTGGCAGAATTGGGGG - Intergenic
904725734 1:32546489-32546511 ATAGAAAGAGCCAGACATGGTGG + Intronic
905888770 1:41506991-41507013 CAACACAGAAGCAGAATTGGTGG + Exonic
906466916 1:46090026-46090048 CTAGAAAGTGGCAGAAGAGAGGG + Intronic
908141659 1:61191427-61191449 CTAGAGACAAACAGAATTGGTGG - Intronic
908693139 1:66805314-66805336 CCAGGAAGAGGGAGAACTGGAGG - Intergenic
908797099 1:67841232-67841254 GAAGAAAGAGGCACAATTAGAGG - Intergenic
908847190 1:68337083-68337105 CTAGGAAGTGGCAGAACTTGAGG - Intergenic
912327015 1:108775556-108775578 CTGGAAAGGGGCAGGAGTGGTGG - Intronic
912418385 1:109527227-109527249 CTAGGAAGAGGCACAGTTGACGG + Intergenic
912849916 1:113114703-113114725 CTGGGAAGAGTCACAATTGGGGG - Exonic
913661698 1:121010688-121010710 CTCGGAAGAGGCCGATTTGGAGG - Intergenic
913996383 1:143654416-143654438 CTCGGAAGAGGCCGATTTGGCGG - Intergenic
914013070 1:143793868-143793890 CTCGGAAGAGGCCGATTTGGAGG - Intergenic
914164756 1:145167317-145167339 CTCGGAAGAGGCCGATTTGGAGG + Intergenic
914505881 1:148288393-148288415 CTGGGAAGAGGCCGATTTGGCGG + Intergenic
914506683 1:148295775-148295797 CTCGGAAGAGGCCGATTTGGAGG - Intergenic
914651694 1:149702477-149702499 CTCGGAAGAGGCCGATTTGGAGG - Exonic
915553024 1:156646219-156646241 CCAGGAAGAGAGAGAATTGGAGG + Intronic
915797181 1:158748195-158748217 CTAAAAAGAGGAAAATTTGGAGG - Intergenic
915844565 1:159250828-159250850 CTAAAAAGAGGAAGAACAGGAGG + Intergenic
917496635 1:175546403-175546425 CAAGCAAGAAGCAGAATTGCCGG + Intronic
917840551 1:178974051-178974073 CTACAAAGTGGCAGGGTTGGGGG - Intergenic
918433083 1:184482449-184482471 GTAGAAAGAGGAGGAATTGTTGG + Intronic
918899069 1:190389292-190389314 CTACTAAGAGGAAGAAATGGGGG - Intronic
918950737 1:191133181-191133203 CTAGTAAGAGGAAGAGTTTGAGG - Intergenic
920627403 1:207615975-207615997 CTAAAAGGAGGAAGAAATGGTGG + Intronic
920706305 1:208252996-208253018 CCAGAAAGAGACACAATTGATGG - Intergenic
920955798 1:210619274-210619296 GAAGAAAGAGGAAGAATGGGAGG - Intronic
921790225 1:219281479-219281501 CCAGAAAGGCTCAGAATTGGAGG + Intergenic
1063209704 10:3868892-3868914 ATAGAATGTGGCAGAATGGGAGG - Intergenic
1064304183 10:14150547-14150569 TGAGATAGAGGCAGGATTGGGGG - Intronic
1065047935 10:21760873-21760895 CTACAAAGAGGCAGTATTTTAGG + Intronic
1067330429 10:45310903-45310925 CCAGAAAGAGTCAAAAGTGGTGG + Intronic
1068967726 10:62929512-62929534 GTAGAAAGAGGGAGAAGGGGAGG + Intergenic
1069587486 10:69618057-69618079 CTAGAAAGAGGCAGAGCCAGGGG - Intergenic
1069604145 10:69729326-69729348 GTGGAAATAGGCAGAATTGAAGG + Intergenic
1069964709 10:72104962-72104984 CCAGAAACAGGCAGACTTTGGGG + Intronic
1070071246 10:73092027-73092049 CTAGAAAGAGGTAGACTGGGTGG - Intronic
1070597899 10:77845573-77845595 CAAGGAAGAGGGAGAAATGGAGG + Intronic
1071236125 10:83650909-83650931 AAATAAAGAGGCAGAATTGATGG - Intergenic
1071964124 10:90834884-90834906 GTAGGAACAGGAAGAATTGGGGG + Intronic
1072184749 10:93025877-93025899 CTAGAAAGAGGCACAGTGTGGGG - Intronic
1072321457 10:94254075-94254097 CCAGGAAGAGGCAGTATTGAAGG + Intronic
1072468204 10:95687062-95687084 ATAGTAAGAGGCAGCATTGAGGG + Exonic
1074021714 10:109591398-109591420 CTGTAAAGAGGCAGAATTGCTGG - Intergenic
1074666890 10:115737761-115737783 TTAGAAAGAAGCAGAATTGGGGG - Intronic
1077536813 11:3128463-3128485 CTGGAGAGTGGCAGCATTGGCGG + Intronic
1079237396 11:18700183-18700205 CCAGAAAGAGGCAGGAAAGGGGG - Intronic
1083175151 11:60945070-60945092 TTAGAATGAAGCAGAAGTGGTGG + Intronic
1084726342 11:70944806-70944828 CTGGAATCAGGTAGAATTGGAGG - Intronic
1084944495 11:72631435-72631457 CTGGAGAGAAGCAGAAGTGGAGG - Intronic
1084950281 11:72661387-72661409 CTGGACAGAGGCAAATTTGGGGG - Intronic
1085374342 11:76044990-76045012 CCAGAAAGTCTCAGAATTGGAGG + Intronic
1087961148 11:104350879-104350901 CTGGAAAGAGACAGAAGTTGTGG + Intergenic
1088403476 11:109446163-109446185 CTAGAAAGAGAAAGCATAGGAGG + Intergenic
1088859386 11:113785622-113785644 CTAGTAAAAGGCAGAAGTGCAGG - Intergenic
1088928615 11:114326996-114327018 CTAGGAGGAGGCAGAGTTGATGG + Intergenic
1088968788 11:114752835-114752857 CAAGAAAGAGGCAAGCTTGGAGG + Intergenic
1089014481 11:115155134-115155156 TTGGAAAGAGGCAGAAGGGGAGG + Intergenic
1089976610 11:122737682-122737704 CTGGAGAGAAGCAAAATTGGCGG + Intronic
1090156188 11:124440989-124441011 CTAGAAACAGGAAGAAGAGGGGG + Exonic
1090582507 11:128175608-128175630 CAATAAAGAGGCAGCATTGGGGG - Intergenic
1092027004 12:5249331-5249353 AAAGAAAGAGGGAGAACTGGAGG - Intergenic
1092165991 12:6342588-6342610 CAAGAAAGAGGGAGACTAGGAGG - Intergenic
1093593248 12:20931758-20931780 TTAGAAGGAGGCTGGATTGGAGG - Intergenic
1093779954 12:23123493-23123515 CTAGAAAGAGAGAGAAATGAAGG + Intergenic
1093862126 12:24178919-24178941 ATAGATAGAAACAGAATTGGAGG + Intergenic
1094358846 12:29608212-29608234 CTAGAATGAGACAGACTAGGAGG + Intronic
1095927649 12:47595004-47595026 ATAGAAAGATGGAGAATTGTTGG + Intergenic
1096504397 12:52083429-52083451 CTAGAAATAGGTAAAACTGGAGG - Intergenic
1097245187 12:57604255-57604277 CTAGAAAGAGGCAGGAGATGAGG + Intergenic
1097865878 12:64558877-64558899 CTAGAAAAAGGCAGGAAAGGAGG - Intergenic
1098131440 12:67354648-67354670 CTGGAAAGAGGCAGAGCTGAGGG + Intergenic
1100735716 12:97527608-97527630 CTACAAAGATGCAGAACTGCTGG - Intergenic
1101138454 12:101770285-101770307 CTAGAGAAAGGAAGAAATGGAGG + Intronic
1101511464 12:105396749-105396771 CTAATAAGAGGCAGAATTTTTGG + Intergenic
1102181832 12:110918486-110918508 CTAAAAACAGGCAGAACTGCTGG - Intronic
1103101646 12:118181281-118181303 TTAGCAAGAGGCAGGAGTGGGGG - Intronic
1103402346 12:120651554-120651576 CTGGAAAATGGAAGAATTGGAGG - Intronic
1104908345 12:132227514-132227536 CCAGACAGAGGCAGAATTGTGGG + Intronic
1104952443 12:132447609-132447631 CTAGACAGAGGCTGAAGTTGGGG + Intergenic
1107128788 13:36872782-36872804 CTGGAAAGAGTCAGGATAGGTGG + Exonic
1108382280 13:49866019-49866041 ATAGAAAGAGGCAGAGACGGGGG + Intergenic
1108613828 13:52111010-52111032 AGAGAAAGAGGAAGAAATGGGGG + Intronic
1108727008 13:53193723-53193745 CTAGAAGGACTCAGAATGGGGGG + Intergenic
1109122793 13:58479122-58479144 CTAGAAAGAGACAGAGATAGAGG - Intergenic
1109719869 13:66261765-66261787 CTGGAAAGAGACAGACTTGTTGG - Intergenic
1112204555 13:97311178-97311200 CTGTAAAGAGCCAGAATGGGAGG + Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114583299 14:23785260-23785282 CTAGAAATTTGCAGAAATGGGGG - Intergenic
1115163973 14:30427495-30427517 CAAGAAGGAGGCAGAATTTGAGG + Intergenic
1115352097 14:32406534-32406556 TTAAAAAGAGAGAGAATTGGAGG + Intronic
1115714735 14:36090599-36090621 CCAGAAAGTGGCAGAAGTTGAGG + Intergenic
1116127820 14:40811817-40811839 GTAGTAAGAGTGAGAATTGGAGG + Intergenic
1117151929 14:52898242-52898264 CAAGAAAGTGGCAGAATTTAAGG - Intronic
1118333485 14:64832479-64832501 GTAGACAGAGGAAGAAGTGGAGG - Intronic
1119995768 14:79252172-79252194 CTTGAAAGAGGTGGAATTGGAGG - Intronic
1119999951 14:79291530-79291552 CTTTAAAGAGGCAGACTCGGAGG + Intronic
1124094483 15:26636443-26636465 AAAAGAAGAGGCAGAATTGGAGG - Intronic
1124697355 15:31875704-31875726 CTTGAAAAAAGCTGAATTGGGGG - Intergenic
1125234815 15:37500907-37500929 CATTAAAGAGGCAAAATTGGTGG + Intergenic
1127162760 15:56207266-56207288 CTAGAAGGAGGAGGAAATGGGGG + Intronic
1127545221 15:59987660-59987682 CTATCATGAGGCAGAATTTGGGG + Intergenic
1127753049 15:62064928-62064950 CTAGTAGGGGGCAGGATTGGTGG - Intergenic
1128740587 15:70081118-70081140 CTAAATGGAGGCAGAATTGGAGG - Intronic
1129689888 15:77707196-77707218 GAAGAAAGAGGGAGAAATGGTGG + Intronic
1130093708 15:80840858-80840880 CAAGAAATAGGCAGGCTTGGAGG + Intronic
1130533709 15:84767719-84767741 ATAGAAAAAGACAGAACTGGAGG - Intronic
1132755551 16:1482806-1482828 ATAGGAAGAGGGAGAATGGGAGG + Intergenic
1133102870 16:3489755-3489777 GTAGAATGTGGCAGAAGTGGCGG - Intergenic
1133842837 16:9425522-9425544 CTGGAACAAGGCAGAATTAGTGG + Intergenic
1134105290 16:11481263-11481285 CTGGAACGAGACAGAAGTGGTGG + Intronic
1135933975 16:26763169-26763191 ACAGAAAGACGCAAAATTGGAGG + Intergenic
1138428629 16:56953127-56953149 CAAGAGAGAGGCAGAATGAGGGG + Intergenic
1138703229 16:58887052-58887074 ATACAAAGGAGCAGAATTGGTGG - Intergenic
1138772213 16:59679374-59679396 CTAGAAAGAAGCAGAAAAGGAGG - Intergenic
1139328808 16:66171964-66171986 CTAGAAACATGCAGCAGTGGGGG - Intergenic
1139848029 16:69934240-69934262 CCAGGAAGGGGCAGCATTGGAGG + Intronic
1140581757 16:76239407-76239429 GTAAAAAGTTGCAGAATTGGAGG + Intergenic
1143160020 17:4863502-4863524 CTAGAAAGGGGAGGAAATGGTGG + Intronic
1144032861 17:11337540-11337562 CTACAAAGAGGCAGAGTTCTTGG + Intronic
1145771117 17:27493966-27493988 CCAGAGAGAGGAAGAAGTGGTGG - Intronic
1145840217 17:27988412-27988434 CTAGAAAGTGGCTGAGTAGGGGG - Intergenic
1146156984 17:30532845-30532867 CTAGTAATAGCCAGATTTGGGGG - Intergenic
1147258017 17:39193668-39193690 CTAAAAGGAGGAAGAATTGGAGG + Intronic
1147324097 17:39662226-39662248 ATGGAAAGAGGCATCATTGGGGG - Intronic
1147417235 17:40301240-40301262 CTAGAGAGATGCAGAAATGAAGG - Intronic
1149199006 17:54160771-54160793 CTGCAAAGAGGCAGGAGTGGAGG - Intergenic
1150427612 17:65089047-65089069 CTAAAAAGAGGCATAATAGAAGG + Intergenic
1150742183 17:67788225-67788247 CTAGCAAGAAATAGAATTGGAGG - Intergenic
1152406891 17:80102947-80102969 CCAGAAAGTTGCAGAATTGATGG + Intergenic
1153731353 18:8016077-8016099 CTAGAAAAAGATATAATTGGTGG + Intronic
1155406822 18:25497778-25497800 CTTGAAAGATTCAGAATTGATGG - Intergenic
1155420957 18:25655336-25655358 CTAGAGAGAGGCAAGTTTGGAGG - Intergenic
1156616290 18:38788974-38788996 CTAGAAAGATGCAGAAAGGATGG + Intergenic
1157188053 18:45557563-45557585 CCTGAAAGAGGCAGCATTTGGGG - Intronic
1158107555 18:53903061-53903083 CTTGAAAGATGCAGAAATGGAGG - Intergenic
1158447343 18:57532834-57532856 ATGGAGAGAGGCAGAATGGGAGG - Intergenic
1160049586 18:75420334-75420356 TTATAAAGAGGTGGAATTGGTGG + Intronic
1160178980 18:76618323-76618345 CTAGAATGAGGCAGAGTTCAGGG - Intergenic
1160212039 18:76889044-76889066 CTAGCAAGAGTCAGAAGTGCAGG - Intronic
1161903411 19:7136657-7136679 CTAGAGAGAAGCAGAGATGGGGG + Intronic
1163601899 19:18254332-18254354 CTTGAAAAAGGAAGAGTTGGAGG + Intronic
1164792796 19:31002483-31002505 CTGGAAAAGGGCAGAACTGGGGG - Intergenic
1166959508 19:46489209-46489231 CTAGAGGGAGGCTGAAGTGGTGG + Intronic
1167299531 19:48670890-48670912 CTGGCGGGAGGCAGAATTGGGGG + Exonic
1167552265 19:50169364-50169386 AGAGAAAGAGGCAGAAAGGGAGG - Intergenic
1167819580 19:51914693-51914715 GTAGAATGAGGCTGAATTTGCGG + Intronic
1202707253 1_KI270713v1_random:32795-32817 CTCGGAAGAGGCCGATTTGGAGG - Intergenic
925287970 2:2728280-2728302 CAAGAAAAAGGCGGAATGGGCGG - Intergenic
925802249 2:7612901-7612923 TTAAAAATAGCCAGAATTGGTGG - Intergenic
926203931 2:10821520-10821542 CTAGAAAGAGGAAGCATTGTTGG + Intronic
926383320 2:12312748-12312770 CTAGGCAGAGACAGAATTAGAGG - Intergenic
926994983 2:18724965-18724987 CTAGGAAGAGGCAGAGCGGGAGG + Intergenic
927153120 2:20206909-20206931 CTAGAAAGAGGGTGAAAGGGAGG + Intronic
927491791 2:23525822-23525844 CTAGAATGAGCCCGAATAGGTGG - Intronic
927758136 2:25725179-25725201 CTAGCCAGTGGCAGAGTTGGGGG - Intergenic
928048547 2:27964707-27964729 ATAGAAAGAGGTGGAAATGGAGG + Intronic
929965337 2:46530334-46530356 TGAGATAGTGGCAGAATTGGGGG - Intronic
930797727 2:55410288-55410310 CTAGAAAGAGCCAGAGATGACGG + Intronic
931062225 2:58543894-58543916 ATAGAAAGTTGCAGAATTGTAGG + Intergenic
931158868 2:59666073-59666095 AGAGAAAGAGGGAGAAATGGAGG + Intergenic
931338983 2:61379854-61379876 TGAGAAAGAGGAATAATTGGAGG - Intronic
931443721 2:62309295-62309317 CTAGAGAGTGGCAGAGCTGGGGG + Intergenic
932608234 2:73178211-73178233 CTAGTAAGTGGCAGAAGGGGGGG - Intergenic
932764400 2:74460791-74460813 CTGGAGAGGGGCAGTATTGGGGG + Exonic
933295008 2:80479625-80479647 CTATAAATAGGCAGATATGGAGG + Intronic
934764094 2:96870557-96870579 CTAGAAAGAGGCAGAATTGGGGG - Intronic
935175691 2:100646857-100646879 CTAGCAAGTGGCAGAGGTGGTGG - Intergenic
935869884 2:107435868-107435890 ACAGAAGGAGGCAGTATTGGAGG - Intergenic
936021376 2:108997535-108997557 ATAGAAAGAGGCAGGATGGCTGG + Intergenic
936660682 2:114540104-114540126 CATGAGAGAGGCTGAATTGGTGG - Intronic
936686515 2:114833629-114833651 GTATTAAGAGGCAGACTTGGAGG - Intronic
936722490 2:115269720-115269742 ATAGAAAGTGGCAGAAGTGATGG - Intronic
936795421 2:116197038-116197060 CTTGAAAGGGGTATAATTGGTGG + Intergenic
938095416 2:128458186-128458208 CTATAAAGGGGCAGACTTGGGGG + Intergenic
938193818 2:129308042-129308064 CTATTAAGAGGCAGCATTGGCGG + Intergenic
940188979 2:151018458-151018480 CTAGGAAGCGGCAGAAATGCTGG - Intronic
943401166 2:187412511-187412533 CCAGAAAGAGTTAGAATTAGAGG - Intronic
943611116 2:190035637-190035659 CTAGAAAAAGGCAAAATTCCAGG - Intronic
943631161 2:190253957-190253979 CTGGAAAGAAGCAGAATTGGGGG - Intronic
943697057 2:190948065-190948087 CTAGAAAGAAGAGGAATTTGTGG + Intronic
946605135 2:221395988-221396010 TTAGGAAGAGGAAGAATTGTGGG + Intergenic
947044252 2:225961444-225961466 CAACAAAGAGGGAGAAGTGGTGG + Intergenic
947472009 2:230409346-230409368 CCAGAGAGAGCCAGAAGTGGTGG - Intergenic
947751771 2:232536288-232536310 ATAGAATGAGGCAGAAGTGATGG + Intronic
948369863 2:237481957-237481979 AGAGAAAGAGGCTGAGTTGGGGG + Intergenic
1170480428 20:16760091-16760113 ATGGAAGGAGGGAGAATTGGTGG - Intronic
1173144720 20:40514728-40514750 ATAGGAAGAGGCAGAAGTGAGGG + Intergenic
1173599592 20:44284027-44284049 TAAGAAAAAGGCACAATTGGTGG - Intergenic
1174716122 20:52760903-52760925 CTGGTCAGAGGGAGAATTGGTGG + Intergenic
1174773936 20:53326120-53326142 CGAGAAAGAGGCAGCAGGGGTGG - Intronic
1175386185 20:58596878-58596900 CTGGATGGAGGAAGAATTGGAGG + Intergenic
1175791792 20:61744656-61744678 TTAGAAGGAGGCAGAGTCGGAGG - Intronic
1176016809 20:62938134-62938156 GTAGAAGGAGGCAGAGGTGGGGG - Exonic
1178285771 21:31324046-31324068 CAAGAAAAGGGAAGAATTGGTGG + Intronic
1178403290 21:32305413-32305435 CTACATAGAGGCAGAGGTGGAGG - Intronic
1178830399 21:36051570-36051592 CTACAGAGAGGCAGAATAGGTGG + Intronic
1178910706 21:36671030-36671052 TTAGAAAATGACAGAATTGGTGG - Intergenic
1179053588 21:37911649-37911671 CCAGAAATAGGCAGAGTAGGAGG - Intronic
1179299174 21:40090999-40091021 CTGCAGAGAGGCAGAAATGGAGG - Intronic
1180594506 22:16964472-16964494 CCTGGAAGAGGCAGAGTTGGAGG - Intronic
1182106522 22:27693792-27693814 CTAGAAAGAGCCTGACTTGCTGG + Intergenic
1184804749 22:46786984-46787006 ATGGAAAGAGGCTGAATTAGAGG - Intronic
1184961314 22:47930865-47930887 TTTGAAAGATGCAGAAATGGGGG - Intergenic
1185002353 22:48253649-48253671 GAAGACAAAGGCAGAATTGGGGG + Intergenic
1185039066 22:48495189-48495211 CTCGAAGGAGGCAGGAGTGGTGG + Intronic
949148623 3:736276-736298 ATAGCAAGAGGCAGACTTGAAGG + Intergenic
950749847 3:15120043-15120065 CTGGAGAGGTGCAGAATTGGGGG + Intergenic
951093419 3:18601009-18601031 CAAGAAAGAGGTAGAAGTGTGGG - Intergenic
952190511 3:31018174-31018196 TTAGAAATAGGTAGAATAGGAGG + Intergenic
952502977 3:33981165-33981187 CTTGAAAGGGGCAGATTTTGTGG - Intergenic
952620448 3:35333247-35333269 AGAGAAAGAGGTAGGATTGGTGG - Intergenic
953691482 3:45123643-45123665 CTCCAGAGTGGCAGAATTGGTGG - Intronic
955451304 3:59069890-59069912 CTTGAAAGGGGAAGAATGGGAGG + Intergenic
957546248 3:81641528-81641550 ATAGAAGGAGGCAGAGTTTGGGG - Intronic
959029385 3:101280491-101280513 CTTGAAATAGGCAGACGTGGAGG - Intronic
959861590 3:111222262-111222284 CCAGAAACAGGCAAATTTGGAGG - Intronic
959900225 3:111652454-111652476 GTAGAGAGTGGCAGAGTTGGAGG + Intronic
963297336 3:143560194-143560216 GTATAAAAATGCAGAATTGGGGG - Intronic
963791640 3:149588931-149588953 CTAGAGAGAGGCACAAAAGGGGG + Intronic
964096379 3:152936010-152936032 CTAGTAATAGAAAGAATTGGAGG - Intergenic
965384034 3:168024525-168024547 CCAGGAAGAGGCAGAAGAGGAGG - Exonic
965455780 3:168898130-168898152 CTAGAACGAAGCACACTTGGTGG - Intergenic
965843316 3:172932269-172932291 TTAGAAAGATGCAGATTTGTTGG + Intronic
966200606 3:177357047-177357069 CTAGAAAGAGGGAGAATGTAAGG + Intergenic
966663098 3:182437068-182437090 CTAGAAAGTGGCAAGATTTGGGG + Intergenic
967012872 3:185453003-185453025 CTGGAGAGGGGAAGAATTGGTGG + Intronic
967080557 3:186045718-186045740 CGAGAAAGAGACAAACTTGGAGG + Intergenic
970129095 4:12846596-12846618 TTAGAAAGGGGCAGTTTTGGCGG + Intergenic
971337782 4:25740085-25740107 TTAGAAATAGCCAGACTTGGTGG - Intergenic
972521086 4:39857441-39857463 AGACAAAGAGGCAAAATTGGAGG + Intronic
972625907 4:40798416-40798438 CTAGAAACAGACAGACTTAGAGG - Intronic
974318267 4:60310142-60310164 CCAGTAAGAGGCAGAACTGTTGG - Intergenic
974672288 4:65048046-65048068 AAAGAAAGAGGCAGAAGGGGAGG - Intergenic
975115069 4:70671080-70671102 CTAGAGAGTGGTGGAATTGGGGG - Intronic
975648832 4:76572067-76572089 CAGGAAAGAGGCAGATATGGAGG - Intronic
976100871 4:81561773-81561795 GTAGAAAGATGCCGAATTTGGGG + Intronic
976427179 4:84918683-84918705 ATAGAAAAAGGGAGAATTGGAGG + Intronic
976730250 4:88254216-88254238 CCAGAGAGAGACAGAAGTGGAGG - Intergenic
977578174 4:98696831-98696853 TTAGAAAGATGAACAATTGGTGG - Intergenic
978613227 4:110567340-110567362 ATAGAAGGTGGGAGAATTGGTGG - Intergenic
979265661 4:118699236-118699258 CAAGGAAGAGGAAGAATTAGAGG - Intronic
979558394 4:122076416-122076438 CCAGAAAGAGGCTGGATTTGTGG + Intergenic
982716648 4:158815766-158815788 CTAGAAAAAGGAAAAATTGGAGG - Intronic
984178713 4:176453568-176453590 CTAGAAAGAGTAAGAGTAGGAGG - Intergenic
984226106 4:177036815-177036837 CTAGGAGGAGGCTGAATTGTGGG - Intergenic
984388037 4:179089774-179089796 CTAGAAAGAGATAGAAAAGGGGG - Intergenic
984520074 4:180790966-180790988 CTCACAAGAGGCAGAAATGGAGG + Intergenic
985569768 5:638620-638642 CTGGAAGGAGGCAGAGATGGGGG + Intronic
987046608 5:14115028-14115050 CTTTAAGGAGCCAGAATTGGAGG - Intergenic
987085048 5:14460379-14460401 CTGGAAAGTGGCAGAGCTGGTGG - Intronic
987955252 5:24730237-24730259 CTGGAAAGAGACAGGATTAGAGG + Intergenic
988490990 5:31705416-31705438 CTAGAAAGAGATAGAATTTGAGG + Intronic
988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG + Intergenic
988844450 5:35114202-35114224 CTTGAGAGAGACAGAATAGGTGG + Intronic
989141838 5:38209222-38209244 CTAAAAAGAAGAAGATTTGGTGG - Intergenic
990232904 5:53734297-53734319 CTAGAAGGTGGTAGAATAGGAGG + Intergenic
990365539 5:55066648-55066670 TTACAAAAAGGAAGAATTGGTGG - Intergenic
991001594 5:61788931-61788953 ATAAATTGAGGCAGAATTGGGGG - Intergenic
991019487 5:61964967-61964989 CTTGAAAGAAGCAGAAGTGGTGG + Intergenic
991393939 5:66183867-66183889 CTAGCAAGAAGCTGAATTTGTGG - Intergenic
992657759 5:78927639-78927661 CCAATCAGAGGCAGAATTGGTGG - Intronic
993536538 5:89093537-89093559 TTAAAAAGAGGCAGAATTGAAGG + Intergenic
994675455 5:102815568-102815590 CAAGAGAGAGGGAGAAATGGGGG - Intronic
995095765 5:108234014-108234036 TTAGAAAAATGCAGAGTTGGGGG + Intronic
995419407 5:111946568-111946590 CTAGAAAGAATAAGAATAGGAGG - Intronic
996014569 5:118518820-118518842 CCATAAAGAGGAAGAATTTGAGG + Intergenic
996606306 5:125327679-125327701 CTAGAAAGATGCTTATTTGGGGG + Intergenic
997745560 5:136297050-136297072 CCAGAAAGAGGAAGCAGTGGGGG - Intronic
997931664 5:138077720-138077742 CTAGGAAGAGTTAGAGTTGGAGG - Intergenic
997948699 5:138224735-138224757 TTAGAAAGAGGGAGAATTGATGG + Intergenic
998344806 5:141452542-141452564 CTAGGAAGAACCAGAACTGGAGG - Intronic
998594198 5:143510972-143510994 CTTGTAAATGGCAGAATTGGGGG - Intergenic
998761279 5:145434720-145434742 CAAGGAAGATGCAGAAGTGGGGG + Intergenic
999261067 5:150239236-150239258 CTAGACAGAGGCAGGGCTGGTGG + Intronic
1001180301 5:169514032-169514054 CTTGGATGTGGCAGAATTGGGGG - Intergenic
1001537486 5:172508463-172508485 CTCCAAAGAGGCAGGATTGGAGG + Intergenic
1002053674 5:176586138-176586160 CTAGGAAGATGCAGGATTAGAGG - Intronic
1002807915 6:595827-595849 CTAGAAAGCGACAGAGTTGCAGG - Intronic
1005781490 6:29197559-29197581 CAAGAATTAGCCAGAATTGGTGG - Intergenic
1006508847 6:34510612-34510634 CTAAAAAGAGGGAGAAAGGGAGG - Intronic
1006704962 6:36011903-36011925 CTAGAAAGGGGAAGGATAGGTGG - Intronic
1006985801 6:38174876-38174898 CTGGAAAGGGGCAGAGGTGGGGG + Exonic
1007113059 6:39324518-39324540 ACAGAAAGAGGCAGAAATGCGGG - Intergenic
1007789684 6:44301876-44301898 TTTGAAAGAGACAGAAGTGGGGG + Intronic
1008478827 6:51962836-51962858 CTAGAATGAGGCATTATTAGGGG - Intronic
1009175785 6:60458341-60458363 CTAAAATCAGGCAGAATTGAAGG - Intergenic
1009619138 6:66049996-66050018 GTAGAATGTGGAAGAATTGGTGG + Intergenic
1010268662 6:73896033-73896055 CTGGAAAGAGGCATCATTGGAGG + Intergenic
1010352500 6:74891071-74891093 CTAGAAATAAGCAGCATCGGTGG + Intergenic
1011716409 6:90109663-90109685 CTGGAAAGAAGCAGGTTTGGAGG - Intronic
1012000643 6:93650478-93650500 TTAGAAAGAGGCAGATTTTCAGG - Intergenic
1012801091 6:103829405-103829427 CAGGAAGGAGGCAGACTTGGTGG - Intergenic
1014131310 6:117837412-117837434 ATAGAATGAGGCAGAAGTGCTGG - Intergenic
1015660298 6:135566965-135566987 CTAGAAGCAGCCACAATTGGAGG - Intergenic
1016158332 6:140843114-140843136 CAAGAGAGAGACAGAATGGGGGG + Intergenic
1016848886 6:148596281-148596303 GTAGTAAGAGACAGAAGTGGTGG - Intergenic
1018882653 6:167900583-167900605 CTTGAAAGAGGTAGCTTTGGTGG + Intronic
1022176081 7:27873258-27873280 CCAGAAAGAGGATGGATTGGAGG - Intronic
1022669197 7:32440109-32440131 ATAGAATGAGGCAGAAGTGATGG - Intergenic
1024561216 7:50647011-50647033 CTAAAAAGAGGCAGAAAGTGTGG + Intronic
1024804222 7:53117852-53117874 CTAGACACAGGAAGAAGTGGGGG + Intergenic
1026472116 7:70702615-70702637 GTAGAAAGAAGCAGAATGAGGGG - Intronic
1027783635 7:82551695-82551717 CTAGAAGGAGGAAGAAGTGAGGG - Intergenic
1028058469 7:86278441-86278463 CTAGAAAGAGGTAGAGTAGGAGG + Intergenic
1028456235 7:91040850-91040872 CTAGAAAGTGAGAGAATTGGTGG + Intronic
1031479953 7:122266520-122266542 AAACAAAGAGGCAGAATAGGAGG - Intergenic
1032915949 7:136490081-136490103 CTTGGAAGAGGCAGAATAGCTGG + Intergenic
1036733817 8:11289308-11289330 CTAGTAAGAGGCAGAACTGAAGG - Intronic
1036935711 8:13000467-13000489 CTGGAAATAGGCAGAGTTTGTGG + Intronic
1037346433 8:17906216-17906238 GTGGAAAGAGGATGAATTGGTGG - Intronic
1037771388 8:21802169-21802191 CTAGAAAGTGGCAGAATCAGGGG - Intronic
1042661367 8:71158084-71158106 GTAGAAAGAGACAGAATTAAAGG + Intergenic
1043258324 8:78162731-78162753 GGAGAAAGAGGTAGAATGGGAGG - Intergenic
1043290162 8:78589036-78589058 GAAGCAAGAGGCAGAATTGAAGG + Intronic
1043403883 8:79911118-79911140 CTAGAATGTGGCAGCATTGAGGG + Intergenic
1043868329 8:85400763-85400785 CAATAAAGAGGATGAATTGGAGG + Intronic
1043961124 8:86419637-86419659 CTAGAAAGAGAGAAAATGGGAGG + Intronic
1044215654 8:89607206-89607228 CTAGAAAGAGGAGAAAATGGAGG - Intergenic
1044564996 8:93653160-93653182 CAAGAAAGAGGGAGAGCTGGTGG - Intergenic
1045405018 8:101857226-101857248 CTAAAAGGAGACAGAGTTGGAGG - Intronic
1046737467 8:117792279-117792301 CTATAAAGAAGGAGACTTGGAGG - Intergenic
1046964332 8:120147002-120147024 AGGGAGAGAGGCAGAATTGGAGG - Intronic
1047453517 8:124988436-124988458 CTTGAAAGATGCAGAGGTGGTGG + Intergenic
1051198134 9:14586326-14586348 CTACAAAGAGGCAAAGTTGAGGG + Intergenic
1051965912 9:22829635-22829657 CTTGCAAGAGGAATAATTGGTGG + Intergenic
1053540114 9:38964980-38965002 GAAGAAAGAGGAAGAATAGGAGG + Intergenic
1053804464 9:41787137-41787159 GAAGAAAGAGGAAGAATAGGAGG + Intergenic
1054140820 9:61528325-61528347 GAAGAAAGAGGAAGAATAGGAGG - Intergenic
1054626026 9:67398941-67398963 GAAGAAAGAGGAAGAATAGGAGG - Intergenic
1055039926 9:71858538-71858560 CTGGAAACAGGCTGTATTGGTGG - Intergenic
1055042819 9:71893707-71893729 CCAGAAACAGGCAGGATTAGAGG - Intronic
1056247687 9:84712989-84713011 ACAGAAAGAAGCAGAATTGTTGG + Intronic
1058313111 9:103531054-103531076 TCAGAAAGAGGCAGAAGTTGTGG + Intergenic
1058324672 9:103680428-103680450 CTACAAACAGGTAGAATTGAAGG - Intergenic
1059008490 9:110430451-110430473 CTAGAAACAGACAGTTTTGGTGG + Intronic
1060139729 9:121200123-121200145 CTAGGAAGTGGCAGTACTGGAGG + Intronic
1060894145 9:127206911-127206933 CTGGGAAGAGGCAGAGTAGGTGG - Intronic
1061226227 9:129282566-129282588 CGAGATAGAGGTAGAAGTGGGGG + Intergenic
1062076390 9:134592274-134592296 CTAGCAAGAGGCTGAGCTGGTGG + Intergenic
1062392482 9:136339511-136339533 CTTGAAGGTGGCAGAATTTGTGG + Intronic
1186391783 X:9167826-9167848 CTGGGAAAAGGCAGAATTGAAGG + Intergenic
1187119477 X:16390340-16390362 CTAAAAAGGAGCAGAATTGCTGG - Intergenic
1188108722 X:26172444-26172466 GTAAAAACAGGCAGAATTGGAGG - Intergenic
1189033766 X:37475766-37475788 CTTGAAAGAGGCAAAGGTGGTGG - Intronic
1189229097 X:39438202-39438224 CTACTGAGAGGCAGAATAGGAGG - Intergenic
1189527894 X:41845320-41845342 ACAGAAAAAGGCAGAATTGGAGG - Intronic
1190356218 X:49607962-49607984 CCAGTAAGAAGCAGATTTGGGGG + Exonic
1190731175 X:53226775-53226797 CTAGAAAATGGCAGAGCTGGTGG - Intergenic
1190739393 X:53279520-53279542 CTGGAAGGAGGAGGAATTGGGGG + Intronic
1192822200 X:74657136-74657158 CTTGAAAAAGGCAATATTGGTGG - Intergenic
1192872392 X:75196557-75196579 ATAGAAAGAGGCCGAGTTGGTGG + Intergenic
1195501944 X:105612469-105612491 CTTGAAGGAGGGACAATTGGTGG - Intronic
1196378205 X:115058943-115058965 CTAAATATAGGCAGAATAGGTGG + Intergenic
1196871852 X:120120218-120120240 CTAGAAAAAGGGAGAAAAGGTGG + Intergenic
1197613489 X:128665292-128665314 CTAGAAAATGGCAGACTTAGAGG + Intergenic
1197992569 X:132333887-132333909 CTGGAAAGAGGAAGGAATGGCGG - Intergenic
1198140401 X:133797044-133797066 CAAGACAGAGGCAGAACTGCTGG - Intronic
1200143919 X:153916205-153916227 CTAGAAAGAGACAGTGATGGAGG - Intronic
1202098666 Y:21281871-21281893 CTGGAAAGATGCAGAATTCCTGG + Intergenic