ID: 934765015

View in Genome Browser
Species Human (GRCh38)
Location 2:96875760-96875782
Sequence CAGTTACAGCACTGGGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934765015_934765019 5 Left 934765015 2:96875760-96875782 CCTGGGCCCCAGTGCTGTAACTG 0: 1
1: 0
2: 3
3: 24
4: 215
Right 934765019 2:96875788-96875810 CTAAGAACCCAGCGAAACACAGG 0: 1
1: 0
2: 0
3: 7
4: 86
934765015_934765020 11 Left 934765015 2:96875760-96875782 CCTGGGCCCCAGTGCTGTAACTG 0: 1
1: 0
2: 3
3: 24
4: 215
Right 934765020 2:96875794-96875816 ACCCAGCGAAACACAGGCAGAGG 0: 1
1: 0
2: 2
3: 27
4: 232
934765015_934765023 18 Left 934765015 2:96875760-96875782 CCTGGGCCCCAGTGCTGTAACTG 0: 1
1: 0
2: 3
3: 24
4: 215
Right 934765023 2:96875801-96875823 GAAACACAGGCAGAGGCATCAGG 0: 1
1: 0
2: 1
3: 45
4: 379
934765015_934765024 25 Left 934765015 2:96875760-96875782 CCTGGGCCCCAGTGCTGTAACTG 0: 1
1: 0
2: 3
3: 24
4: 215
Right 934765024 2:96875808-96875830 AGGCAGAGGCATCAGGAGACTGG 0: 1
1: 0
2: 3
3: 55
4: 549

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934765015 Original CRISPR CAGTTACAGCACTGGGGCCC AGG (reversed) Intergenic
900634846 1:3657948-3657970 CAGGTCCAGGGCTGGGGCCCGGG - Intronic
900872324 1:5312901-5312923 CACTTACAGCAGTGTGGCCTAGG - Intergenic
901941801 1:12667966-12667988 GACTGACAGCACTGAGGCCCAGG - Intergenic
903029695 1:20454915-20454937 CACAGACAGGACTGGGGCCCTGG - Intergenic
904187143 1:28714335-28714357 CAGTCACAGGACTGGAGCCCTGG - Exonic
905488576 1:38325711-38325733 CTGTTACAGCTCAGGGGCCTTGG - Intergenic
906597437 1:47091985-47092007 CTATTACAGCACGGGAGCCCTGG - Intronic
906754150 1:48292863-48292885 CAGTGACTGCACTGGTTCCCAGG + Intergenic
907293319 1:53432519-53432541 CAGATAGATCACTGGAGCCCAGG - Intergenic
907938696 1:59066222-59066244 CAACTCCAGCTCTGGGGCCCTGG - Intergenic
915513005 1:156396983-156397005 CAGGCAGATCACTGGGGCCCAGG - Intergenic
916277514 1:163010839-163010861 CAGGTAGAGCACTGGAGCCCAGG + Intergenic
922754960 1:228090601-228090623 CAGCCACTGCACTGGGGGCCAGG + Intronic
1066155459 10:32672141-32672163 CAGTAACAGCACTTATGCCCAGG + Intronic
1067593254 10:47532307-47532329 CAGTTACAGCACAGATGCCTGGG + Intronic
1067640366 10:48040417-48040439 CAGTTACAGCACAGATGCCTGGG + Intergenic
1067835041 10:49633213-49633235 CTGGAAAAGCACTGGGGCCCGGG - Intronic
1068917110 10:62444482-62444504 CATTACCAGCCCTGGGGCCCAGG - Intronic
1069874014 10:71550688-71550710 GAGTAACAGCACTGGGGCCCTGG - Intronic
1070816372 10:79327239-79327261 CACTCACAGGTCTGGGGCCCAGG - Intergenic
1074187930 10:111113251-111113273 TGGTGACAGCACTGAGGCCCTGG - Intergenic
1076096562 10:127738089-127738111 CAGGTAGGGCACTGAGGCCCAGG - Intronic
1080735121 11:35006561-35006583 CATTTCCAGGAGTGGGGCCCTGG - Intronic
1083150076 11:60786465-60786487 CCGTGAGAGCTCTGGGGCCCTGG - Intronic
1084554482 11:69867823-69867845 CAGCTGGAGCAGTGGGGCCCGGG - Intergenic
1084982809 11:72840782-72840804 CAGTAACAACACAGGGGCCACGG + Intronic
1085129361 11:74024879-74024901 CAGTTTTAGCACTGGAACCCAGG - Intronic
1085526762 11:77168492-77168514 CAGGTGAAGAACTGGGGCCCAGG + Intronic
1085660031 11:78355582-78355604 CAGTAACATCACTTGAGCCCAGG + Intronic
1087725113 11:101707717-101707739 CTGGCACAGCACTGGGACCCTGG - Intronic
1092007978 12:5085672-5085694 CTGTTACAGGACTGGGACCTAGG - Intergenic
1092763056 12:11826810-11826832 CAGTTACATATCTGTGGCCCTGG + Intronic
1093186305 12:16023088-16023110 CAGTTACAGCCCAGGGACACAGG + Intronic
1095550161 12:43427345-43427367 GAGTTACAGCAATGTGGTCCAGG - Exonic
1096606313 12:52768919-52768941 CAGTGGCAGCACTGGGGGCAGGG - Exonic
1098046472 12:66406415-66406437 CACTAACAGAACTGGGACCCTGG - Exonic
1099507729 12:83500101-83500123 TGCATACAGCACTGGGGCCCTGG - Intergenic
1100316288 12:93447666-93447688 CAGTCCCTGCACTTGGGCCCAGG - Intergenic
1102616860 12:114162252-114162274 CATTTAGAACACTGAGGCCCTGG + Intergenic
1104800838 12:131554449-131554471 CAGTGGCAGCACCGGGGCCCAGG + Intergenic
1105700660 13:22933429-22933451 CAGGTACAGCACTGGGGCCTGGG + Intergenic
1105853455 13:24355584-24355606 CAGGTACAGCACTGGGGCCTGGG + Intergenic
1106484516 13:30160471-30160493 CAGCCCCAGCTCTGGGGCCCAGG + Intergenic
1107946319 13:45420188-45420210 CTGTTACAGAACCAGGGCCCAGG + Intergenic
1109639299 13:65166830-65166852 TAGTGACAGAACTGAGGCCCAGG + Intergenic
1115520870 14:34231807-34231829 CACGTACAGCACTGAGACCCAGG + Intronic
1118698543 14:68410232-68410254 CTGTTGCAGCATTTGGGCCCAGG + Intronic
1119701202 14:76756071-76756093 CAGTGACAGTACTAGGGGCCTGG - Intergenic
1121236089 14:92392106-92392128 CAGTAACATCAATAGGGCCCCGG - Intronic
1121458086 14:94051939-94051961 CAGTCACAGCACTGGTGGCAAGG - Intronic
1121776174 14:96592639-96592661 CAGTCACCGCACAGGTGCCCTGG + Intergenic
1121854354 14:97253053-97253075 CACTTACAGGTCTGGGGCCAGGG + Intergenic
1122477439 14:102020561-102020583 CAGCTGCAGCTCTGGGGCACTGG + Intronic
1123110645 14:105865430-105865452 TACTTCCAGCACTGGGGCCAGGG - Intergenic
1123171153 14:106373925-106373947 CAGCTACAGCAGTGGGGCGCAGG - Intergenic
1123222890 14:106873018-106873040 CAGCTGCAGGAGTGGGGCCCAGG - Intergenic
1124583570 15:30984798-30984820 CAGCCTCAGCACAGGGGCCCAGG + Intronic
1124839955 15:33232516-33232538 CAGTTAAAGCAGTGGCGGCCAGG + Intergenic
1127732349 15:61812489-61812511 CAGTGGCAGGGCTGGGGCCCAGG + Intergenic
1129982087 15:79882450-79882472 CTGTTACAGCACTCGGGCTCAGG + Intronic
1130772239 15:86936088-86936110 CAGGTGCAGCCCTGGTGCCCAGG + Intronic
1132143106 15:99410731-99410753 GAGCTACAACTCTGGGGCCCAGG - Intergenic
1132553818 16:564208-564230 CAGTTCCAGGGCTGGGGCCCTGG + Exonic
1132607972 16:801359-801381 CAGCTGCAGCACTTGGGCTCGGG + Intergenic
1133130055 16:3671434-3671456 CAGTCACAACCCTGGGGCACAGG + Intronic
1133454117 16:5928184-5928206 CAGGAACACCACTTGGGCCCAGG - Intergenic
1135689641 16:24525931-24525953 CAGTTTAAACACTGGGGGCCAGG - Intergenic
1136284186 16:29231573-29231595 CAAGGACAGCACTGGGGACCTGG - Intergenic
1138599336 16:58045784-58045806 CAGTTACAGCCCTGGGGTTCAGG - Exonic
1139512897 16:67437393-67437415 CAATTGCAGCACTGAGGCACTGG - Exonic
1139691210 16:68643269-68643291 CAGATGCAGAACTGAGGCCCAGG + Intronic
1140405247 16:74706006-74706028 CAGTTAGATCACTTGAGCCCAGG + Intergenic
1141130804 16:81435181-81435203 CCTTCACACCACTGGGGCCCTGG + Intergenic
1141184973 16:81780224-81780246 CAGTTCCATCAGTGGGACCCTGG + Intronic
1141574920 16:84957720-84957742 CATTCTCAGCACTGAGGCCCCGG - Intergenic
1142693277 17:1619862-1619884 CAGTGACTGCACAGGGGCCGTGG + Intronic
1143595298 17:7910416-7910438 CTGGTTCAGAACTGGGGCCCGGG - Exonic
1145788720 17:27611005-27611027 CAGATACAGCACAGGTGACCGGG - Intronic
1145961081 17:28886858-28886880 CAGTGCCAGCCCTGGGGCACTGG + Intronic
1146538578 17:33674732-33674754 CAGGGACAGCACTAGAGCCCTGG - Intronic
1147437234 17:40424486-40424508 CAGTTTCAGCTCTGTTGCCCAGG + Intergenic
1148243630 17:46016035-46016057 CAGCTACAGCACAGGAACCCTGG + Intronic
1149571533 17:57675652-57675674 CAGTGGCAGCGCTGGAGCCCGGG + Intronic
1150462266 17:65362608-65362630 CAGATACAGGACTGGGACTCAGG + Intergenic
1152811739 17:82385731-82385753 GATTTCCAGCACTGGGCCCCAGG - Intergenic
1153746244 18:8182831-8182853 CAGTCACAGCACTTGGGGGCAGG - Intronic
1154340778 18:13500429-13500451 CAGTTTCAAAACTGGGCCCCGGG - Intronic
1154937784 18:21078504-21078526 CCATTACAGCACAGGTGCCCCGG - Intronic
1156949274 18:42873912-42873934 CAGTTAGTGAACTGTGGCCCTGG + Intronic
1160819971 19:1053349-1053371 CTGGTACAGCACTGGGTGCCCGG + Exonic
1160875381 19:1294246-1294268 CGGTTACATGACAGGGGCCCTGG + Intronic
1161317688 19:3625816-3625838 CTGAGCCAGCACTGGGGCCCCGG + Intronic
1161528072 19:4769682-4769704 CTGTTTCAGCACCGGGGCTCAGG + Intergenic
1162582472 19:11539567-11539589 CAGGTACAGCGCTCGGACCCTGG + Intronic
1163033684 19:14560076-14560098 CAGCTGCAGCAGTGGTGCCCAGG - Intronic
1163700115 19:18782673-18782695 CAGCTGCAGCACTGAGGCCTTGG + Intergenic
1164103590 19:22082399-22082421 CAGTCACATCACTTGGGACCAGG - Intronic
1164397594 19:27879579-27879601 CCATTACAGCACAGGAGCCCTGG + Intergenic
1164520161 19:28972988-28973010 CAGTCACAGAGCTGGGGCCGGGG + Intergenic
1165259341 19:34598840-34598862 CATCTACACCACTGGGTCCCTGG - Intronic
1166232782 19:41435203-41435225 CAGGTACAGCACTTGAGCCCAGG - Intronic
1166346002 19:42166264-42166286 CATTCACAGCACTGGGCACCAGG + Intronic
1167641299 19:50683465-50683487 GAGTTAGAGCACTGGTGGCCAGG - Intronic
1202647878 1_KI270706v1_random:158078-158100 CAGTCCCTGCACTGGGACCCAGG + Intergenic
925274361 2:2638324-2638346 CAGTGACATCCATGGGGCCCAGG - Intergenic
925338484 2:3115872-3115894 CAGTTACAGCTCTGGAGATCTGG - Intergenic
925971435 2:9109354-9109376 CAGTTAGATCACTTGAGCCCAGG + Intergenic
927206827 2:20616380-20616402 CAGCTTCAGCCCTGGGACCCAGG - Intronic
927547780 2:23970062-23970084 CAGGCACATCACTGGAGCCCAGG + Intronic
929135094 2:38616348-38616370 CATGTACAGCACTGAGACCCAGG + Intergenic
929428229 2:41865374-41865396 AAATCCCAGCACTGGGGCCCAGG - Intergenic
932564354 2:72896218-72896240 CACTTACAGCCATGGGGCTCTGG + Intergenic
934765015 2:96875760-96875782 CAGTTACAGCACTGGGGCCCAGG - Intergenic
937370339 2:121293265-121293287 CACTTCCAGCACTGGGGAGCGGG + Intergenic
939815765 2:146895300-146895322 AAGTTACAAAACTGAGGCCCAGG + Intergenic
941821902 2:169851863-169851885 AAGTGACAGAGCTGGGGCCCAGG + Intronic
942247750 2:174023602-174023624 CAGTTTCAGCAGAGCGGCCCTGG + Intergenic
947268302 2:228306005-228306027 CCATTACAGCACAGGAGCCCTGG - Intergenic
948295977 2:236860992-236861014 TAGATACAGCACTGGGGCTCAGG + Intergenic
948458226 2:238117092-238117114 CAGGTTCAGCAGTGGGGTCCTGG - Intronic
1172023838 20:31934680-31934702 CACTTGCAGCCCTGGGCCCCGGG - Exonic
1172024015 20:31935749-31935771 CACTTGCAGCCCTGGGGCCTGGG + Intronic
1172751152 20:37252228-37252250 CAGAAACAGGCCTGGGGCCCAGG + Intronic
1172862694 20:38067798-38067820 CATTTTCAGCACTGTGCCCCGGG + Intronic
1172907859 20:38382402-38382424 CAAGTACAGCATTGGGCCCCAGG + Intergenic
1174686144 20:52457141-52457163 GAGTTACAGCATTGAAGCCCGGG - Intergenic
1176385702 21:6137736-6137758 CAGTCACACCACTGGGGACCGGG - Intergenic
1176603973 21:8814651-8814673 CAGTCCCTGCACTGGGACCCAGG - Intergenic
1178361423 21:31951664-31951686 CAGGTACAGCACTGGAGACAGGG - Intronic
1179060463 21:37974532-37974554 GAATTACAGCACTGGCTCCCTGG - Intronic
1179117491 21:38507443-38507465 CAGTGTCAGCACTGGGGCTCCGG - Intronic
1179202303 21:39236187-39236209 CCTTTGCAGGACTGGGGCCCTGG - Intronic
1179737771 21:43400516-43400538 CAGTCACACCACTGGGGACCGGG + Intergenic
1179813796 21:43890164-43890186 CAGTTACAGCACTAGGGGGACGG - Intronic
1180346257 22:11706228-11706250 CAGTCCCTGCACTGGGACCCAGG - Intergenic
1182318974 22:29466098-29466120 CAGGCAGAGCCCTGGGGCCCAGG + Intergenic
1182413592 22:30206859-30206881 CAGTTGCAGCACAGTGGCCCTGG - Intergenic
1183408325 22:37641011-37641033 CAGTGGAAGCACTGGGGTCCAGG + Intronic
1184975324 22:48057666-48057688 CAGTTCCTGCAGTGTGGCCCGGG + Intergenic
949470571 3:4391708-4391730 CAGGTAGATCACTGGAGCCCAGG - Intronic
950107809 3:10399227-10399249 TTGTTACAGCCCTGTGGCCCTGG - Intronic
950447147 3:13044927-13044949 CAGGTCCAGGACTAGGGCCCAGG - Intronic
952685545 3:36143841-36143863 CAGTTACTGCATTGGGTTCCTGG + Intergenic
953912072 3:46898333-46898355 CAGTCAGAGCCCTGGGACCCAGG - Intronic
954091385 3:48287033-48287055 GAGTTATAGGACTGGGGACCAGG - Intronic
954643494 3:52116420-52116442 CAGTTCAAGCACTGAGGCTCTGG + Intronic
955494080 3:59512964-59512986 CATTTACAGCACTGTGATCCCGG + Intergenic
958738630 3:98040877-98040899 CAGTGGCAGCACTGGAGCCCAGG - Intergenic
959838642 3:110949371-110949393 CTGTAACAGCAGGGGGGCCCTGG + Intergenic
961634602 3:128325125-128325147 CAGTGACAGCTCTGGGCTCCAGG - Intronic
963119397 3:141763509-141763531 TAGGCACAGCACTGGGGCCCTGG - Intergenic
963901884 3:150740947-150740969 CCATGACAGCACTGGGGTCCGGG - Intergenic
966625248 3:182008827-182008849 AAGTTACAGAACTGGGACCCAGG + Intergenic
969314270 4:6372096-6372118 GAGGACCAGCACTGGGGCCCCGG - Intronic
969352651 4:6606566-6606588 CATTTCCAGCACTGGAGCTCAGG + Intronic
969367570 4:6707198-6707220 CAGTTCCAGCACTGGGGAGATGG - Intergenic
972646856 4:40976686-40976708 CAGACACAGCACTGGGGCTCAGG + Intronic
973374143 4:49276265-49276287 CAGTCCCTGCACTGGGACCCAGG + Intergenic
973383269 4:49333974-49333996 CAGTCCCTGCACTGGGACCCAGG - Intergenic
973386877 4:49518989-49519011 CAGTCCCTGCACTGGGACCCAGG - Intergenic
974717842 4:65693888-65693910 CAGGCAGAGCACTTGGGCCCAGG - Intergenic
976849040 4:89524144-89524166 CAGTAACAGCAGAGGGGCCTTGG - Intergenic
980913645 4:139015462-139015484 CAGTTCCAGGGCTGTGGCCCAGG - Intergenic
981150061 4:141369995-141370017 CAGCTACTGCAGTGGGTCCCTGG - Intergenic
982055845 4:151548189-151548211 CAGCACCAGCACTGGGACCCAGG + Intronic
984617337 4:181913611-181913633 CAGTTACAGAACAGGTGACCAGG + Intergenic
986283624 5:6344112-6344134 GAGTCACTGCACTGGGGCACGGG + Intergenic
986439025 5:7762399-7762421 CAGTCAGAGCTCAGGGGCCCAGG - Intronic
987105104 5:14630926-14630948 CAGGTGCAGCACTGGGGGCATGG - Intergenic
989157354 5:38356820-38356842 CAGTTTCAGCATTAGAGCCCAGG - Intronic
991045796 5:62221505-62221527 GGGATACAGCACTGGGGCCAGGG - Intergenic
991192797 5:63895611-63895633 CAGATATAGCACTGGGGCAAAGG - Intergenic
993362082 5:86990078-86990100 CAGGTACATCACTTGAGCCCAGG - Intergenic
995511739 5:112917599-112917621 CAAGTACAGGACTAGGGCCCTGG + Intronic
996014714 5:118520255-118520277 CTCTCCCAGCACTGGGGCCCAGG - Intergenic
997367144 5:133333289-133333311 CAGTGAGAGGCCTGGGGCCCCGG + Intronic
999154256 5:149447031-149447053 CAGTGACATTACTGGGCCCCTGG - Intergenic
999462950 5:151772316-151772338 CAGAGACCGCCCTGGGGCCCAGG - Intronic
1001761613 5:174212328-174212350 CAGTTCCAGCCCTGGGCTCCGGG + Intronic
1002056916 5:176603464-176603486 CATTTACACCTCTGGGTCCCTGG + Intronic
1002300820 5:178256492-178256514 GGGTTCCAGCACTCGGGCCCTGG - Intronic
1002932471 6:1644035-1644057 CAGTCACAGCGCTGGGCCCTGGG - Intronic
1005138240 6:22596494-22596516 CAGTTACAGGACAGAGCCCCTGG - Intergenic
1005682190 6:28218308-28218330 CAGTGACGGCTGTGGGGCCCCGG - Intergenic
1006035547 6:31208664-31208686 CAGTCACAGCAATGGAGCCTCGG + Intergenic
1006075456 6:31529512-31529534 CAGTTACAGCCCCTGGGCCAGGG + Intronic
1006808627 6:36805642-36805664 CCGTCCCAGCCCTGGGGCCCAGG - Intronic
1008334224 6:50280948-50280970 CAGGAAGATCACTGGGGCCCAGG + Intergenic
1009683095 6:66923966-66923988 CTATTACAGCACAGGAGCCCTGG - Intergenic
1009895532 6:69745127-69745149 GAGTTACAGCACTGTGGGCTGGG - Intronic
1010253240 6:73730133-73730155 CAGTTACATCACAGGGCTCCTGG - Intronic
1014003422 6:116390294-116390316 CAGTTGCAGCACTTGAGCCCAGG - Intronic
1014177074 6:118342657-118342679 TAGCTACACCACCGGGGCCCTGG - Intergenic
1014547543 6:122750668-122750690 CTTTAACAGCAGTGGGGCCCAGG - Intergenic
1015866287 6:137730000-137730022 AATGTACAGCACTGGGGCCCTGG - Intergenic
1017758686 6:157551388-157551410 CAGTGACAGGCCTGGGACCCTGG + Intronic
1020129114 7:5549482-5549504 CAGTTACAGCCCAGAGACCCAGG - Intronic
1024002399 7:45199330-45199352 CATTGACATCACTGGGGCCCAGG - Intergenic
1024018934 7:45347873-45347895 CTGAGACAGGACTGGGGCCCTGG - Intergenic
1025710431 7:63902718-63902740 CAGTTACATAACAGGGTCCCAGG - Intergenic
1032464639 7:132136340-132136362 AAGTTCAAGCACAGGGGCCCAGG - Intronic
1033530370 7:142256909-142256931 CAGTTACATCACAGAGGCCATGG + Intronic
1036753005 8:11455084-11455106 CACGTGCAGCACTGGGGCCGGGG - Intronic
1038130154 8:24721056-24721078 CAGTTACATCACTAGGCCGCTGG - Intergenic
1041932595 8:63303564-63303586 CAGGTAAATCACTTGGGCCCAGG - Intergenic
1045259139 8:100556999-100557021 CAGTTATTCCACTGTGGCCCAGG - Intronic
1045442979 8:102233398-102233420 CAGATACAGCACTTGAGCCCTGG + Intronic
1046628215 8:116597860-116597882 CAGTTCCAGCTTTGGGGCTCTGG + Intergenic
1046916577 8:119683981-119684003 TAGTTTCAGCACTGGGTCCCTGG + Intergenic
1047989240 8:130268256-130268278 CAGGTAGAGCACTTGAGCCCAGG + Intronic
1050177197 9:2880550-2880572 AAATTACAGCACTGGTGCTCAGG + Intergenic
1051047547 9:12893075-12893097 CAGTGAAACCACTGGGTCCCAGG - Intergenic
1051768269 9:20547721-20547743 CAGATAGATCACTTGGGCCCAGG + Intronic
1052096637 9:24391594-24391616 CACCTACACCACTAGGGCCCTGG - Intergenic
1052949094 9:34193530-34193552 CAGTTGCATGTCTGGGGCCCTGG + Intronic
1053643437 9:40108212-40108234 CAGTCCCTGCACTGGGACCCGGG + Intergenic
1053762712 9:41357278-41357300 CAGTCCCTGCACTGGGACCCGGG - Intergenic
1054541315 9:66268392-66268414 CAGTCCCTGCACTGGGACCCGGG - Intergenic
1056803456 9:89710282-89710304 CAGTAACAGCACTGGGTTCTAGG + Intergenic
1056882134 9:90405330-90405352 TAGTGACAGCACTTGGACCCAGG + Intergenic
1057678479 9:97154227-97154249 CACTAACACCACTAGGGCCCAGG + Intergenic
1059327261 9:113511664-113511686 CTGTGACAGCCCTGGGCCCCTGG + Intronic
1059982898 9:119792740-119792762 CAGTTACAGCTCTGGGGTACTGG - Intergenic
1060103032 9:120856856-120856878 TAGTTGCAGCACCTGGGCCCTGG + Exonic
1060976963 9:127770581-127770603 CAGATGGAGCACTGGGTCCCGGG + Intronic
1061438008 9:130579087-130579109 CAGTGTAAGAACTGGGGCCCGGG + Intronic
1061484632 9:130914141-130914163 TAGCCACAGCACTGAGGCCCAGG + Intronic
1061534292 9:131238202-131238224 CGGAGCCAGCACTGGGGCCCGGG + Intergenic
1061606190 9:131712620-131712642 CAGTTACAGAACCTGGGCTCAGG + Intronic
1062186781 9:135222457-135222479 CAGCCACAGTACTGGGCCCCTGG + Intergenic
1062382909 9:136296176-136296198 CAATCACAGCCCTGGGGCCGTGG - Intronic
1062708250 9:137957116-137957138 CAACCACAGCAGTGGGGCCCGGG - Intronic
1203759165 EBV:3070-3092 CGATCACAGCACTGGGGCCCGGG - Intergenic
1203697817 Un_GL000214v1:114176-114198 CAGTCCCTGCACTGGGACCCAGG + Intergenic
1203551385 Un_KI270743v1:166810-166832 CAGTCCCTGCACTGGGACCCAGG - Intergenic
1188996401 X:36891560-36891582 CAGTGAAATCACTGGGGCCTGGG - Intergenic
1189342505 X:40215124-40215146 CAGTAGGATCACTGGGGCCCAGG + Intergenic
1189615393 X:42778187-42778209 TAGTTAAAGCACCAGGGCCCTGG + Intergenic
1199288885 X:146084007-146084029 CACTTTCAGCAATGGGGACCTGG + Intergenic
1199712373 X:150478664-150478686 CAGATAAAGGACTGGGGACCAGG + Intronic
1200457125 Y:3407479-3407501 CCGTTACAGCACAGGACCCCGGG - Intergenic
1200768295 Y:7099969-7099991 CTGTTGCTCCACTGGGGCCCTGG + Intergenic
1201278750 Y:12322184-12322206 CAGTTGCAGGCCTGGGACCCTGG + Intergenic