ID: 934767657

View in Genome Browser
Species Human (GRCh38)
Location 2:96889041-96889063
Sequence GATCTGGGTGGTGCCCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934767652_934767657 2 Left 934767652 2:96889016-96889038 CCACTCGCGCTCAGTCGGGGGCC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 934767657 2:96889041-96889063 GATCTGGGTGGTGCCCCCGCAGG 0: 1
1: 0
2: 0
3: 10
4: 119
934767647_934767657 23 Left 934767647 2:96888995-96889017 CCTCGAGAAAGCTGACTAGAGCC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 934767657 2:96889041-96889063 GATCTGGGTGGTGCCCCCGCAGG 0: 1
1: 0
2: 0
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934767657 Original CRISPR GATCTGGGTGGTGCCCCCGC AGG Intronic
900521224 1:3106385-3106407 GGACTGGGTGGTGGCCCCACTGG + Intronic
900577711 1:3391893-3391915 AATCGGGGTGCTGCCCCTGCTGG + Intronic
900605505 1:3521866-3521888 GGTCTGGATGGTGCCCAAGCAGG + Intronic
902516778 1:16993781-16993803 GATGGGGGTGGTGCCCCTGAAGG - Exonic
902625757 1:17675362-17675384 GATGTTGGTGATGCCCCCTCTGG + Intronic
903215824 1:21842826-21842848 GAACTGTGTGGTGCCCGGGCAGG - Exonic
903217864 1:21852975-21852997 GAACTGCGTGGTGCCCGGGCAGG - Exonic
907771480 1:57469371-57469393 GATCTTGTTGATGCCCCTGCTGG - Intronic
911552898 1:99306123-99306145 GATCTGGGTGGTGACTGCCCAGG - Exonic
913531155 1:119735250-119735272 GATCCTGGTGCTGCCCCAGCAGG + Intronic
917920442 1:179745185-179745207 GATCTGCCTGATGCCCCAGCAGG - Intronic
922597925 1:226828057-226828079 GATATGAGTGGTGACCCCTCAGG - Intergenic
1072365269 10:94703114-94703136 CATCTGGCTGGTGCCCCACCAGG - Intronic
1074560694 10:114532831-114532853 AATCTGGGTTGTGCCTCTGCTGG - Intronic
1075715100 10:124551266-124551288 GACCTGGGGCGTGCCCCAGCGGG - Intronic
1076236718 10:128869161-128869183 CATCTGGATGGTGCTCCGGCGGG + Intergenic
1076762018 10:132610638-132610660 GCACTGGGTGGTCCCCACGCTGG - Intronic
1077538659 11:3136194-3136216 GCTCTGGGTGGGGCCCCCATTGG - Intronic
1078642485 11:13109351-13109373 GATCTGAGTGGGGCCCAGGCAGG + Intergenic
1079690035 11:23406348-23406370 GACCTGGCTGCTGCCCCTGCTGG - Intergenic
1081730472 11:45368644-45368666 GACCTGTGTGGTGCCCCAGAGGG + Intergenic
1084174684 11:67417185-67417207 GTTCTGTGTGGTGCCCCTGGGGG - Intronic
1086425481 11:86678447-86678469 GGTCAGGGTGGTGGCCCAGCAGG + Intergenic
1090205183 11:124879926-124879948 CATCTGGGTGGAGCACCCGCTGG - Exonic
1090646859 11:128773300-128773322 GAGATGGGTGGTGCCCTGGCTGG + Intronic
1092053257 12:5488439-5488461 GATCCTGGTGGAGCCTCCGCTGG - Intronic
1092735910 12:11582593-11582615 GATCTGGCTGCTGCCCAGGCTGG - Intergenic
1097186421 12:57198839-57198861 GAGCTGGGTGGTGGCCAGGCTGG - Intronic
1097251418 12:57634465-57634487 TATCTGGTTGGTGCCCCCAGCGG + Intergenic
1102029045 12:109729496-109729518 TATTTGGGTGGTGCCCTCGTGGG - Intronic
1103839050 12:123847973-123847995 TATCTAGGTGGGGCCCCCGCCGG + Exonic
1105790486 13:23793441-23793463 GATCTGGGTGGTGGTTCCACAGG + Intronic
1107032900 13:35871270-35871292 GCTCTTGGTGGTGCTCCTGCGGG + Exonic
1113378392 13:109783913-109783935 GAGGTGGGTGCTGGCCCCGCAGG + Exonic
1113834902 13:113322326-113322348 GCTGTGGGTGGTGCCCTGGCGGG + Exonic
1116217239 14:42032628-42032650 TATCTGGGTGGTTCTCCCACAGG - Intergenic
1121101408 14:91253033-91253055 CCTCTGGGTGGTCCCCCAGCTGG - Intronic
1125575770 15:40754746-40754768 GCCCTGGGTGGTGCCCGTGCCGG - Exonic
1129644741 15:77419843-77419865 GTTCTGGGTGGCGCCGCCGCCGG - Intronic
1131806103 15:96124543-96124565 GGTCTGGCTGGTGCCCACACAGG + Intergenic
1135737894 16:24947303-24947325 GAGCTGGGTGCTGTCCCAGCTGG - Intronic
1138515358 16:57533060-57533082 GACCTGGGTGGTGCCTGCCCTGG - Intronic
1141266885 16:82505810-82505832 GAGCTGGGTGGGGCCCTGGCAGG + Intergenic
1141693651 16:85610240-85610262 GCTCTGGGAGGTGCCTCCGTAGG + Intergenic
1142005044 16:87685626-87685648 GTTCTGGCAGGTGCCCCCGACGG - Intronic
1142114644 16:88350315-88350337 GACCTGGATGGTGCCCACACAGG + Intergenic
1142284247 16:89165303-89165325 GAGCTGGGTGGTGCCCAGACTGG - Intergenic
1144887668 17:18474718-18474740 GTTCTGGGTGGTGGTCCCACAGG - Intergenic
1145144548 17:20469582-20469604 GTTCTGGGTGGTGGTCCCACAGG + Intergenic
1145176000 17:20700984-20701006 GTTCTGGGTGGTGGTCCCACAGG + Intergenic
1147583232 17:41638469-41638491 GATCTGGGTGGGGCCGCCTGGGG - Intergenic
1147768599 17:42852660-42852682 GATCTGAGTGGTGTCGCCGCAGG - Exonic
1147771191 17:42868592-42868614 GATCTGAGTGGTGTCGCCGCAGG - Intergenic
1147875127 17:43615597-43615619 GATGTGGGCCGTGCCCCTGCTGG - Intergenic
1148271837 17:46267366-46267388 CATCTGGCTGGTGACCCTGCTGG + Intergenic
1148771258 17:50068243-50068265 GTTCTGGGTGAAGCCACCGCTGG - Exonic
1149995611 17:61404703-61404725 GAGGTGGGTGGTTCCCGCGCGGG - Exonic
1150693489 17:67384357-67384379 GATCAGGGTGGTGCTGCCTCTGG + Intronic
1151324151 17:73368554-73368576 GCTCTGTGAGGTTCCCCCGCTGG + Exonic
1151746495 17:76014450-76014472 GATCTGGCTGGGGCCGTCGCTGG + Exonic
1152257572 17:79249034-79249056 GCTCTGGGTTCTGGCCCCGCTGG - Intronic
1152596863 17:81242018-81242040 GATCTGGGTGGTGGGTCTGCAGG + Intergenic
1154119900 18:11643841-11643863 GAGGTGGGTGGTGCCCAGGCTGG - Intergenic
1159207136 18:65267179-65267201 CATCTGAGTGGTGCCCCTGTGGG + Intergenic
1161578939 19:5070232-5070254 GGGCTGGGTGGTGTCCCCGTTGG + Intronic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1161865380 19:6828990-6829012 GATCTGGGTGGAGCCTGGGCAGG + Intronic
1162841918 19:13363121-13363143 GATGTGGGTGGTGCCACCAGAGG - Intronic
1163152334 19:15422812-15422834 GACCTGGCTGCTGCCCCTGCTGG + Exonic
1163827266 19:19530577-19530599 GCTCTGACTGCTGCCCCCGCAGG - Intronic
1164798841 19:31058922-31058944 GTTCTGGGAGGTGACCCCTCAGG + Intergenic
1165361741 19:35341163-35341185 GATCTGGGAGGTGGCCCGGCTGG + Intronic
925156421 2:1651749-1651771 GAGGTGGGTGGTGCCCTGGCTGG - Intronic
926223982 2:10954616-10954638 CATGTGGGTGGGGCCCCAGCAGG - Intergenic
934767657 2:96889041-96889063 GATCTGGGTGGTGCCCCCGCAGG + Intronic
942084705 2:172433056-172433078 GATCTGTGTAGCACCCCCGCTGG + Intronic
942485788 2:176438570-176438592 GACCTGGGTGGTGGCTCTGCAGG + Intergenic
945967147 2:216200605-216200627 GATCTGGGTGGTGAGCACCCAGG - Intronic
1168977208 20:1975761-1975783 GATCTGAGTGGTGACCACACAGG + Intergenic
1172035507 20:32008012-32008034 GAGCTGGGGGGTGACCCGGCAGG + Intergenic
1172215704 20:33234174-33234196 AGTCTGGGTGGTGCCCCCAAGGG - Intergenic
1173166262 20:40689057-40689079 GCTCTGGGCTGTGCCCGCGCAGG + Exonic
1175437644 20:58965568-58965590 GAGCTGGGTGGTCCCTCCCCAGG - Intergenic
1175584070 20:60123504-60123526 GTTCTGGGTGTTGTCCACGCTGG + Intergenic
1175767174 20:61599568-61599590 GATCTGGGGGCTGCCCCGCCTGG - Intronic
1176008769 20:62880748-62880770 GAGCGGGGCGGTGCCCTCGCCGG + Exonic
1176169949 20:63692263-63692285 GAACTGGGTGGTGCCCAGGCAGG + Intronic
1176230540 20:64030472-64030494 GGTCTGGGTGCCGCCCCCACAGG + Intronic
1180080937 21:45487264-45487286 GGCCTGGGTGGAGCCCCCCCGGG - Intronic
1180977380 22:19855676-19855698 GATCTGGGTGCTGACTCGGCAGG - Intergenic
1181837078 22:25619685-25619707 GATCTGGCTGTTGCCCAGGCTGG + Intronic
1183301301 22:37060421-37060443 GATCTGGGTGGTGTCTGCCCTGG + Intronic
950634616 3:14306079-14306101 GATCCGGGTGGTGGCTCCACGGG + Intergenic
951425301 3:22537775-22537797 GATCTGGGTGGTGACTACACAGG + Intergenic
953682225 3:45048289-45048311 GATCTGAGTGGTGCCCTCCATGG - Intergenic
954382472 3:50227050-50227072 GATGTGGGTGATTCTCCCGCTGG - Intronic
955041272 3:55320056-55320078 GATCTTGGTGGTGCTCAGGCAGG + Intergenic
963312211 3:143721471-143721493 AATCTCGGTGGTGCCTGCGCAGG + Intronic
963872019 3:150427268-150427290 GATCTGGGTGCTGCCCACACAGG - Intronic
968442694 4:632429-632451 GATCTGTGTGGTGCCATCTCAGG + Intronic
968656838 4:1782382-1782404 GGTCTGGGTGGTGGCTCTGCTGG - Intergenic
973547491 4:51996131-51996153 GCTCTGGGGAGTGCCCCCGTTGG + Exonic
984929376 4:184833209-184833231 CAGCTGGGTGGTTCCCCTGCTGG + Intergenic
987303488 5:16617197-16617219 GAGCTGGGCGGTGTCCCCGGGGG + Intergenic
990147890 5:52783504-52783526 GACCAGGGTGGTGCCCTGGCAGG - Intergenic
993265561 5:85722083-85722105 CATCTGGCAGGTGCCCCCTCTGG + Intergenic
994710536 5:103259189-103259211 AAACTGGGTGGGGCCCGCGCGGG + Intronic
995110936 5:108428267-108428289 CATCTGGTTGGTGCCCCTCCAGG - Intergenic
999292565 5:150436178-150436200 GATCTGGGTTCTGCCACCCCTGG - Intergenic
1001926782 5:175643018-175643040 GGTCTCGGTGGTGCCCAGGCTGG - Intergenic
1002709842 5:181188708-181188730 AATCTTGGTGATGCCTCCGCTGG + Intergenic
1003549145 6:7086359-7086381 GCTCTGGGTCCTTCCCCCGCTGG + Intergenic
1011609787 6:89139725-89139747 GATAAGGGTGGGGCCCCAGCTGG + Intergenic
1014641195 6:123912757-123912779 TATTTGGCTGGTGCCCCTGCAGG - Intronic
1015964693 6:138686453-138686475 GATCTGGCTGTTGCCCAGGCTGG - Intronic
1018387993 6:163322100-163322122 GATCTGGAATGTGCCCCAGCTGG - Intergenic
1019192482 6:170260889-170260911 GATCTGGGAGCTGCCCCCAGAGG + Intergenic
1019919938 7:4157127-4157149 GATCTTGGTGAAGCCCCAGCCGG - Intronic
1023863829 7:44229526-44229548 CAGGTGGGTGGTGCGCCCGCAGG + Intronic
1024633718 7:51269492-51269514 GGTCTGGGTGGTGCATCGGCAGG + Intronic
1039123282 8:34172981-34173003 GATCTGGGTGTTACTCCCACTGG - Intergenic
1046129867 8:109954183-109954205 CATTTGGGTGGTGCCCATGCAGG - Intergenic
1048182622 8:132210162-132210184 GCTCTGGGTGGGGCCCATGCTGG + Intronic
1055533498 9:77211976-77211998 GATCTAGGTTGTGCCCCTGATGG + Intronic
1060747354 9:126146341-126146363 GATCTTGGTGGTGTCCCAGCAGG - Intergenic
1060941635 9:127546016-127546038 GCTCTGGGTGGTGACGCTGCTGG - Intronic
1062378566 9:136275962-136275984 GCACTGGGGGGTGCCCCAGCGGG - Intergenic
1062676387 9:137747746-137747768 GATCTGGGTGGTGGCCACACAGG - Intronic
1186656136 X:11614039-11614061 GAAGTGGGTGGTGCCCGCACAGG - Intronic
1196307979 X:114127190-114127212 CATCTGGCAGGTGCCCCCTCTGG - Intergenic