ID: 934769213

View in Genome Browser
Species Human (GRCh38)
Location 2:96897194-96897216
Sequence TCCAGGGAGTGGGGGGGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 514}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934769213_934769222 -6 Left 934769213 2:96897194-96897216 CCTATTCCCCCCCACTCCCTGGA 0: 1
1: 0
2: 4
3: 41
4: 514
Right 934769222 2:96897211-96897233 CCTGGAATGTAAACTCTCTGAGG 0: 1
1: 1
2: 12
3: 99
4: 566
934769213_934769223 -5 Left 934769213 2:96897194-96897216 CCTATTCCCCCCCACTCCCTGGA 0: 1
1: 0
2: 4
3: 41
4: 514
Right 934769223 2:96897212-96897234 CTGGAATGTAAACTCTCTGAGGG 0: 1
1: 3
2: 28
3: 249
4: 1079

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934769213 Original CRISPR TCCAGGGAGTGGGGGGGAAT AGG (reversed) Intronic
900489344 1:2939119-2939141 TCCTGAGAGTTGGGGGGGATGGG + Intergenic
900978862 1:6035000-6035022 ACCAGGGAGTGTGGGGGAGACGG + Intronic
901109716 1:6785235-6785257 TCCTGGGAGTGGGTGGGGAGGGG + Intergenic
901660393 1:10795201-10795223 TCCAGGGGGCGCGCGGGAATGGG - Intronic
901934286 1:12617114-12617136 TCCAGGGAGTGGGGGGCCGCAGG - Intronic
902184792 1:14717172-14717194 TCCAGTGAGTAGGGGGGAGTGGG - Intronic
902275139 1:15334263-15334285 TGCAGGGGGTGGGGGTGAAGGGG - Intronic
902342146 1:15790969-15790991 TCCAGGAACTGGGGGGAAATAGG + Intergenic
902364370 1:15961794-15961816 ACCAGGGAGGTGGGGGGAATGGG + Intronic
902391555 1:16109961-16109983 TCCAGGGAGAGGGAGGGACAGGG + Intergenic
902513753 1:16979409-16979431 TCCAGGGAGAGGGGAGGGAAAGG + Intronic
902966918 1:20011879-20011901 TCCAGGGGGTGGTGGGGAATGGG + Intergenic
903031313 1:20466238-20466260 GCCATGGGGTGGGGGGGCATTGG - Intergenic
903419297 1:23206885-23206907 TCCAGGAACTGGTGGGGAATGGG + Intergenic
904896092 1:33819584-33819606 TGCAGGGAGTGAGGGGGGAGGGG + Intronic
905135738 1:35798315-35798337 GTCAGGGAGTGGGGGGAAAGGGG - Intergenic
906038421 1:42767282-42767304 CCCAGGGAGTGGGGAGGATAAGG + Exonic
906038898 1:42771047-42771069 AATAGGGAGTGGTGGGGAATTGG - Intronic
906128567 1:43442380-43442402 GCCAGGGACTGGGTGGGAAGAGG + Intronic
906645076 1:47469010-47469032 TGCAGTGAGTGGGAGGGACTGGG + Intergenic
906714112 1:47954316-47954338 TCCAGGGAAAGGGAGGGAAATGG - Intronic
907969571 1:59367719-59367741 TCCCTGGAGTGGGAGGGAAAGGG + Intronic
907995466 1:59626911-59626933 TACAGGGGGTGGGTAGGAATGGG + Intronic
908254514 1:62292051-62292073 TCCTGGGGCTGGGAGGGAATGGG - Intronic
908257429 1:62314507-62314529 ACCAGGATGTGGAGGGGAATCGG + Intronic
908395518 1:63721998-63722020 TCCCTGGAGTGAGAGGGAATTGG + Intergenic
910136145 1:83972268-83972290 GCCAGGGGTTGGGAGGGAATGGG - Intronic
912237831 1:107871324-107871346 TGGGGGGAGAGGGGGGGAATGGG - Intronic
912684140 1:111748866-111748888 TCCAGGGAGTGAAAGGGAAGGGG - Intronic
914461149 1:147886632-147886654 GCCCAGGAGTGGGTGGGAATAGG - Intergenic
915135507 1:153728538-153728560 GCCAGGGACTGGGGGGCAAGAGG - Exonic
915515374 1:156409578-156409600 CCCAGGGAGTGGGGTGGAATGGG - Intronic
915700640 1:157791377-157791399 GTCAGGGATTGAGGGGGAATGGG + Intergenic
916309827 1:163385708-163385730 AGAAGGGAGTGGGGTGGAATAGG + Intergenic
917558198 1:176114592-176114614 GGGAGGGAGTGGGGGGGAAAGGG + Intronic
918095371 1:181329944-181329966 CCAAGGGAGTGGAGGGGAGTAGG + Intergenic
918283588 1:183029639-183029661 GCCAGGGAGTGGGGCAGAAAGGG - Intronic
919781212 1:201222476-201222498 TGCAGGGAGAGGGGTGGACTAGG - Intronic
920602259 1:207339644-207339666 TCCAGGGAGTGTGGGTGAAGTGG - Intronic
920847206 1:209604232-209604254 TCAAGGGAGTGAGGTGGAAAGGG + Intronic
921389163 1:214602276-214602298 TCTAAGGAGTGGGTGGGATTAGG + Intergenic
922602741 1:226869858-226869880 GCCAGGGGCTGGGGGGGAAGAGG + Intergenic
922856344 1:228778222-228778244 TACAGGCAGTGGGTGGGAAGGGG + Intergenic
922900185 1:229130433-229130455 ACCAGGGAGTGGGAGGGACAGGG + Intergenic
923045684 1:230354079-230354101 TCCAGGGAATGGAGGGGCACAGG + Intronic
923458548 1:234187374-234187396 TCCAAGGAGAGGGGGGAAAATGG + Intronic
923687115 1:236161076-236161098 TGGAGGGCGTGGCGGGGAATTGG - Intronic
924647656 1:245894077-245894099 TCCAGGGTGGAGTGGGGAATTGG + Intronic
1063006813 10:1979569-1979591 TCCAGGCAGATGGGGGGAAGCGG + Intergenic
1063036830 10:2294352-2294374 GTCAGGGGGTGGGGGGGAAGGGG + Intergenic
1063553580 10:7056702-7056724 GCCTGGGAATGGGAGGGAATGGG + Intergenic
1063923783 10:10957551-10957573 TCTAGGGAGAGGGGAGGGATGGG - Intergenic
1064244894 10:13660448-13660470 TCCAGGGACTGGGGAGGAGGAGG + Exonic
1065133267 10:22643811-22643833 TTCAGGGAGGAGGAGGGAATGGG - Intronic
1065138043 10:22691979-22692001 TCCAGGGACTGGGGTGGTGTGGG + Intronic
1065227167 10:23556092-23556114 GGCAGGGAGTGGTGGGGGATGGG + Intergenic
1066163698 10:32762213-32762235 TTCAGGGAGTGGAGGGAACTTGG + Intronic
1066529071 10:36316399-36316421 TCCTGGGAGTGGGTGGAAAGCGG + Intergenic
1066746060 10:38604786-38604808 CCCAGGGAGTGGGAGGGACAGGG - Intergenic
1067511107 10:46895726-46895748 CCCAGAGAGTGGGAGTGAATGGG + Intergenic
1067651146 10:48156136-48156158 CCCAGAGAGTGGGAGTGAATGGG - Intergenic
1068127691 10:52861905-52861927 GTCAGGGGGTGGGGGGCAATGGG - Intergenic
1069942523 10:71965000-71965022 TCCTGGGAGCGCGGGGGATTTGG + Intronic
1070612110 10:77940510-77940532 CCCAGGGAGTGGGGATGTATCGG - Intergenic
1071846256 10:89524284-89524306 ACAAGGGAGTGGGTGGGAGTGGG - Intronic
1072045442 10:91650132-91650154 TCCAGGGGGTGGGGGGCAAGGGG + Intergenic
1072635479 10:97175050-97175072 GCCAGGGACTGGTGGAGAATGGG - Intronic
1072755987 10:98021294-98021316 TCCAGGTAGAGGGGAGGAAGAGG - Intronic
1073046904 10:100644737-100644759 TCCAGGGTCTGGGAGGCAATGGG + Intergenic
1073099689 10:101000034-101000056 TCCAGAAAGTGGGGGCGACTGGG - Exonic
1075514803 10:123100285-123100307 TGCTGGGAGTGGGTGGGGATTGG + Intergenic
1076178964 10:128391160-128391182 TCCAGGGTGAAAGGGGGAATAGG + Intergenic
1076541933 10:131220210-131220232 TCCAGGCTGTTGGGGGCAATAGG - Intronic
1076717428 10:132373452-132373474 TCCAGGGAGGGCGGGGGGAGAGG + Intronic
1076830432 10:132991768-132991790 TCCAGGCACTGGGGGGCCATTGG - Intergenic
1077112658 11:868825-868847 TCCAGGGAGTGGGTGGGCCTGGG - Exonic
1077609565 11:3636022-3636044 GCCTGGGGGTGGGGGGAAATGGG + Intergenic
1078223887 11:9374681-9374703 TGCAGGGGGTGGGGGGGCAAAGG - Intergenic
1079399299 11:20092968-20092990 TGCAGGGGGTGGGGGGGTAGGGG - Intronic
1080707265 11:34708006-34708028 GCCAGGGAGTGGAGGAGAAGTGG + Intergenic
1080719178 11:34832584-34832606 TCCAGGAAGTGGGGAGGCAGTGG + Intergenic
1081718589 11:45268947-45268969 TGCAGGGAGTGGGGAGGAGGGGG + Intronic
1082067854 11:47915493-47915515 GACGGGGAGTGGGGGGGAATTGG - Intergenic
1082192305 11:49261323-49261345 TGCAGGGAGTGAGGGGGTATAGG - Intergenic
1082849344 11:57752111-57752133 TGCAGTGAGTGGGGGGGTTTCGG - Intronic
1083358722 11:62089268-62089290 TCCAGGGACTGTGGTGGAAGAGG + Intergenic
1083594533 11:63912600-63912622 TCCAAGGAGTGGGGGGGCAGAGG - Intronic
1083947322 11:65931433-65931455 TCCAGGAAGTGGGAGGGGAGGGG - Intergenic
1084033061 11:66492362-66492384 TCCAGGGGCTGGGGAGGATTAGG - Intronic
1086286965 11:85261952-85261974 TCCAGCCAGTTGGGGTGAATGGG + Intronic
1086879565 11:92137621-92137643 GCCAGGGAGTTCAGGGGAATTGG + Intergenic
1087016627 11:93560415-93560437 GCCAGGGACTGGTGGGGAGTGGG - Intergenic
1087682558 11:101232864-101232886 TCCAGTGAGTGGCTGGGAAGGGG + Intergenic
1087706430 11:101497849-101497871 GTCAGGGGGTGGGGGGCAATGGG - Intronic
1088352782 11:108909178-108909200 TCCAGGGAGGTGGGGGGAATAGG - Intronic
1088797931 11:113279836-113279858 TGCAGGGGGTGTGGGGGAAAGGG - Intergenic
1089071229 11:115701186-115701208 TCCAGTGGGTGGGGAGGACTGGG + Intergenic
1089112191 11:116065548-116065570 CCCTGGGATTGGGAGGGAATTGG + Intergenic
1089303508 11:117512817-117512839 CCCAGGGAGAGGGAGGGAAGTGG - Intronic
1089646304 11:119881776-119881798 TCCAGGGAGTGTGGAGAAATGGG - Intergenic
1091224538 11:133949732-133949754 TGAAGGGAGTGGGGAGGAAGGGG + Intronic
1093892123 12:24534806-24534828 TCCCAGGAGTGGGTGGGAAACGG + Intergenic
1094029041 12:25989773-25989795 TCAAGGGTGTGGTGGGGCATGGG + Intronic
1094121837 12:26983221-26983243 GGCAGGGAGTGGGGGGGAGGTGG + Intronic
1094130679 12:27071615-27071637 TTCATGGAGTGGGGGGGAAAAGG - Intergenic
1094502043 12:31030454-31030476 TCCAGGGTGTGCAGGGGAAATGG - Intergenic
1094502115 12:31030985-31031007 TCCAGGGTGTGCAGGGGAAATGG - Intergenic
1095786057 12:46109996-46110018 CCCAGGGAGTGGGGAGTAACAGG - Intergenic
1096123395 12:49103061-49103083 TACAGGGTCTGGGAGGGAATGGG - Intronic
1096585808 12:52618853-52618875 CCCAGGGAGTGGTGGGGCCTGGG + Intergenic
1097053492 12:56237268-56237290 CCCAGGGAGTGAGGGGGACAGGG - Exonic
1097246350 12:57609822-57609844 TCCAGGGACTGGGTGGGGGTGGG + Intergenic
1098552791 12:71782103-71782125 ACTAGGGAGTGATGGGGAATGGG - Intronic
1099184583 12:79503690-79503712 TCCACCCAGTGGGGAGGAATGGG - Intergenic
1099809470 12:87562202-87562224 GTCAGGGAGTGGGGGGCAAGGGG + Intergenic
1100465911 12:94845158-94845180 TCCAGGGAGAGGTGGGGAACTGG + Intergenic
1100666119 12:96755466-96755488 GTCAGGGAGGGTGGGGGAATAGG - Intronic
1101089157 12:101266970-101266992 TACAGGGAGGGGTGGAGAATTGG - Intergenic
1101568606 12:105932983-105933005 TTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1101652644 12:106691405-106691427 TCCTGCCAGTGGGGTGGAATTGG - Intronic
1101710001 12:107256462-107256484 CCCAGGGAGGGGAGGGGAAAGGG - Intergenic
1102418761 12:112787393-112787415 GCCAGGAAGAGGGGGAGAATGGG - Intronic
1102503585 12:113369761-113369783 GCCAGGGACTTGGGGGGAGTGGG + Intronic
1102570615 12:113825023-113825045 GCCAGGGGGTGGGGTGGCATTGG - Intronic
1103419723 12:120770642-120770664 GCCAGTGAGTGGGGAGGAACAGG - Intronic
1104088432 12:125494896-125494918 TCCAGGGAGGAGGGGGGAGAGGG - Intronic
1104546581 12:129718338-129718360 TCCAGGGAGGGGAGGGGAAGGGG + Intronic
1106358943 13:29012294-29012316 TCCCGGGAGTGGGCGTGAGTCGG - Intronic
1106376819 13:29197214-29197236 TCCAGGGGATGGGGGGCAAGGGG - Intronic
1108440339 13:50446755-50446777 GCCAGAGAGTGGGGGGAAATGGG - Intronic
1111128755 13:83946878-83946900 TCAAGTGAGTTGGTGGGAATGGG - Intergenic
1113571423 13:111361001-111361023 TCCAGATAGTGGGTGGGAAGTGG + Intergenic
1115385421 14:32790763-32790785 GCCAGGGAGTGGGGGGCAAGGGG - Intronic
1116180592 14:41527223-41527245 GTCAGGGAGTGGGGGGCAAAGGG + Intergenic
1116885743 14:50219519-50219541 TCCTGAGAGTGGGGAGAAATAGG + Intronic
1117494285 14:56286339-56286361 TGCAGGGAGATGGGAGGAATTGG + Intronic
1117792303 14:59353757-59353779 TCGGGGGAGTGGGTGGGTATTGG + Intronic
1118648284 14:67861966-67861988 TTCAGTCAGTGGGGGGGAAGGGG + Intronic
1118685400 14:68285671-68285693 GCCAGGGAGTGGGCGGGAGGAGG + Intronic
1118687952 14:68310516-68310538 TGCAGGGTGTGAGGGGGAAGGGG + Intronic
1118846101 14:69548861-69548883 TCCTGGGAGTGGGTGGGGGTGGG + Intergenic
1119823541 14:77639061-77639083 GCTAGGGAGTGGGTGGGAAGGGG + Intergenic
1120835518 14:89035453-89035475 TCCAGGGAGCAGGAGGGAAGCGG - Intergenic
1121993960 14:98587205-98587227 TCCAGGGAGTGGGGCAGGAATGG + Intergenic
1122143564 14:99676116-99676138 GCCAGGGGGTGGGGGGGATGCGG - Exonic
1122190200 14:100036238-100036260 TCCATGGACTGGGGTGGGATCGG - Intronic
1123162184 14:106289180-106289202 TCCAGGGAATGGGCTGGAGTTGG - Intergenic
1124355117 15:28989628-28989650 TCCAGGGGGTGCCTGGGAATTGG + Intronic
1125142280 15:36422432-36422454 TTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1126453313 15:48834065-48834087 GCCAGGCAGTGGGGAGGCATTGG - Intronic
1126838882 15:52696279-52696301 TGCAGGGTGTGTAGGGGAATGGG - Intronic
1127444094 15:59042534-59042556 TACAAGGACTGGGGGGAAATGGG - Intronic
1128591976 15:68906216-68906238 CCCAGGGAGTGGAGGGAGATGGG - Intronic
1128771938 15:70289443-70289465 AACAGGGAGTGGTGGGGACTGGG - Intergenic
1129235729 15:74222779-74222801 TCGGGGGAGTGGGGTGGGATGGG - Intergenic
1129741785 15:77992856-77992878 TGGGGGGAGTGGGGGGGAGTGGG - Intronic
1130354079 15:83114163-83114185 TCCATGGAGTGGGGAGGAACAGG - Intronic
1132717962 16:1301459-1301481 TGCAGGGAGTGGGAGGGCAGGGG - Intergenic
1132884582 16:2177013-2177035 TGCTGTGAGTGGGGGGGCATGGG + Exonic
1133070068 16:3240368-3240390 TCTGGGGAATGGGGGAGAATGGG + Intergenic
1133231769 16:4370331-4370353 AGCAGGGAGTGGTGGGGACTGGG + Intronic
1133484726 16:6208857-6208879 TCTAGGAAGTGGTGGGGACTGGG - Intronic
1133725259 16:8531369-8531391 TCCAAGGAGGGGGTTGGAATGGG - Intergenic
1134224869 16:12381882-12381904 TGACGGGAGTGGGGGTGAATGGG - Intronic
1135185719 16:20314069-20314091 TCCAGGGGATGGGGGGCAAGGGG + Intronic
1135198371 16:20414031-20414053 TCTGGGGAGTTGTGGGGAATGGG + Intronic
1136226589 16:28864143-28864165 TCCAGGGAGTAGGGTCGGATCGG + Intronic
1136374302 16:29856273-29856295 TCCAGGGAGGTTGGGGGAGTGGG - Intergenic
1136450807 16:30353430-30353452 TCCAGGGAGGGTGGGGGTGTGGG + Exonic
1136737001 16:32474858-32474880 CCCAGGGAGTGGGAGGGACAGGG + Intergenic
1138619659 16:58200788-58200810 TGCATAGAGTGGGGAGGAATTGG + Intergenic
1139358475 16:66381743-66381765 TCCAGGCAGTGGGCTGGATTGGG - Intronic
1139422271 16:66856058-66856080 TCTCCGGAGTGGGGAGGAATGGG + Intronic
1139664713 16:68447788-68447810 CCAAGGGAGGAGGGGGGAATAGG + Intronic
1139934174 16:70556100-70556122 TCCAGGGTTTTGGGGTGAATTGG + Intronic
1139959646 16:70710277-70710299 TGCAGGGAATGGGTGGGAAGGGG - Intronic
1140303113 16:73777167-73777189 TCCAGGGAGTGGCGGAGGACAGG - Intergenic
1140761932 16:78117379-78117401 TCCCAAGAGTGGAGGGGAATGGG - Intronic
1141185760 16:81785957-81785979 TCCAGGGAGAAGGAAGGAATCGG - Exonic
1141506545 16:84482064-84482086 TGCAGGGAGTGGGTGGGCACGGG - Intronic
1141530008 16:84639754-84639776 TGCAGGGAATGGTGGGAAATGGG - Intergenic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1141977897 16:87529780-87529802 TTCAGGGAGTGGCAGGGAAATGG + Intergenic
1141999841 16:87658014-87658036 TCCTGGGTGTGGAGGGGACTGGG + Intronic
1142139527 16:88466580-88466602 TCCTGGCAGTGGGAGGGGATGGG + Intronic
1203016070 16_KI270728v1_random:354719-354741 CCCAGGGAGTGGGAGGGACAGGG - Intergenic
1203034405 16_KI270728v1_random:627877-627899 CCCAGGGAGTGGGAGGGACAGGG - Intergenic
1142496058 17:306908-306930 CCCAGGAAGTGTGGGGGCATCGG - Intronic
1143179059 17:4973074-4973096 TGCAGGGAGTGGGGTGGGCTGGG - Intronic
1143596371 17:7916487-7916509 CCCCGGGAGTAGGGAGGAATGGG - Intergenic
1143866639 17:9928495-9928517 TCCAGGCAGTGGGGTGGGAGGGG - Intronic
1144462167 17:15467058-15467080 CCCAGGGGATGGGGGGGAACGGG + Intronic
1144747219 17:17623886-17623908 TGCAAGGAGTGGGGAGGACTCGG + Intergenic
1144785136 17:17827253-17827275 TCCAGGGAATGGGTGGGAAAGGG + Intronic
1144825027 17:18100962-18100984 CCCAGGGAGAGCTGGGGAATGGG + Intronic
1144891065 17:18494628-18494650 GCCAGGGAGAGGGGAGGAGTGGG + Exonic
1145794766 17:27649243-27649265 GCCAGGGAGAGGGGAGGAGTGGG + Exonic
1145942278 17:28748865-28748887 TCCAGGGAGAGGAGAGGAGTGGG - Intronic
1146282614 17:31554786-31554808 TCCAGTGAGTGGTGGGGGAGGGG - Intergenic
1146915043 17:36673044-36673066 TCCTGGGAGTGGGGGGCCTTGGG + Intergenic
1147629818 17:41922816-41922838 TCCAGAGAGTGAGGGGGAAGAGG + Intronic
1148020115 17:44547915-44547937 TCCAGGGAAGGAGGGGGAGTGGG + Intergenic
1148075387 17:44932637-44932659 TGCAGGGTGGGGGCGGGAATGGG + Intronic
1148934694 17:51155495-51155517 TCAGGGGACTGGGGAGGAATTGG + Intronic
1150747731 17:67829462-67829484 TCCGGGGGGTGGGGGGCAAGGGG - Intronic
1151003913 17:70411956-70411978 GTCAGGGGGTGGGGGGCAATGGG - Intergenic
1151516768 17:74601521-74601543 GCCAGGGATTGGTGGGGAAGTGG + Intergenic
1151890817 17:76949492-76949514 TAGAGGGAGGGTGGGGGAATCGG - Exonic
1152077979 17:78170260-78170282 ACCGGGGAGGGGTGGGGAATGGG - Intronic
1152310170 17:79545250-79545272 GCGAGGGAGAGGGCGGGAATGGG - Intergenic
1152817739 17:82418344-82418366 GCCATGGAGTGGGCGGGACTGGG - Exonic
1152891136 17:82882312-82882334 GTCAGGGGCTGGGGGGGAATGGG - Intronic
1153244502 18:3060704-3060726 GCCAGGAAGTGAGGGGGAAGAGG - Intergenic
1153940181 18:9970153-9970175 CCCAGGGAGTGGGAGGGGAGAGG + Intergenic
1155117595 18:22784434-22784456 TCCTGGGAGTGCAGGGGAAGGGG - Intergenic
1155369328 18:25081125-25081147 TCCAGGGGGTGGGAGGGAGGGGG + Intronic
1155529862 18:26756190-26756212 GCCAGGAAGTTGGGGGGAAAAGG - Intergenic
1156848538 18:41698672-41698694 CCCAGGGAGTGGAGGGAGATAGG + Intergenic
1157365940 18:47064389-47064411 AGCAGGGAGTGGTGGGGAACGGG + Intronic
1157569864 18:48705113-48705135 TTCAGGGAGGGTGGGGTAATGGG + Intronic
1159530320 18:69647644-69647666 TCCAGGGAGTGGGGAGTGCTTGG - Intronic
1160006466 18:75072660-75072682 TGCAGGGAGTGTGGGGGCCTCGG - Intergenic
1160016391 18:75144006-75144028 TCCTGGGAGTGGGTTGGAGTGGG - Intergenic
1160134404 18:76260301-76260323 TCCTGGGGGTGGGGGGGAGGGGG + Intergenic
1160470115 18:79124190-79124212 GCCTAGGAGTGGGAGGGAATGGG + Intronic
1160655939 19:269968-269990 TCCAGGGAGCGTGGGTGGATAGG - Intergenic
1160655990 19:270306-270328 TCCAGGGAGCGTGGGTGGATAGG - Intergenic
1160942688 19:1627736-1627758 CCCAGGGGGTGGGGCGGAAAGGG + Intronic
1161114874 19:2491104-2491126 TCCAAGGTGTGGGGGGAAAGGGG + Intergenic
1161364074 19:3868490-3868512 GCCGGGGAGTGGGTGGGGATGGG - Intronic
1161565710 19:5000933-5000955 TGCAGGGGGTGGGCAGGAATGGG - Intronic
1161694616 19:5759155-5759177 TCCTGGGAGAGGCGGGGACTGGG + Intronic
1161778012 19:6274379-6274401 TCCAGGTGGTGTGGGGGAAGGGG - Intronic
1161985512 19:7651214-7651236 TGCAGGGAGTGGGAGGGAGGTGG + Intergenic
1162061729 19:8100188-8100210 TCCAGGGACTGAGGGGGATGGGG + Intronic
1162098453 19:8324830-8324852 TCTGGGGAGTGGGGAGGAAGAGG + Exonic
1163578064 19:18122142-18122164 CCCAGGGGGTGGGGGGTCATGGG + Intronic
1163607294 19:18282029-18282051 TCCGGGGACTGGAGGGGGATGGG + Intergenic
1163782354 19:19257200-19257222 CTCAGGGAGAGGGGGAGAATGGG + Exonic
1164046478 19:21547039-21547061 GTCAGGGTGTGGGGGGCAATGGG - Intronic
1164802844 19:31092010-31092032 TCCAGGGCTTTGGGGGGACTGGG - Intergenic
1165169325 19:33880065-33880087 GCCAGGGAGGGGGTGGGAACAGG - Intergenic
1165259898 19:34604194-34604216 TCAATGGAGTGAGGGGAAATGGG - Intronic
1166266530 19:41688065-41688087 TCCTGGGAGTGGGTGGGAGGAGG - Intronic
1166305281 19:41934036-41934058 GCCAGGAAGTGGGGAGGAAGGGG + Intergenic
1166932875 19:46312140-46312162 TCCTGGGGGTGGGGCGGAGTGGG - Exonic
1166997811 19:46728125-46728147 CCCTGGGGGAGGGGGGGAATGGG + Intronic
1167290985 19:48625032-48625054 TCCAGGGAGCGGGTGGGAGCAGG - Intronic
1167493111 19:49803011-49803033 TCCTGGGAGTGGTGGGGGAGGGG + Intronic
924998648 2:386584-386606 GCCAGGGAATGGGGAGGAGTTGG - Intergenic
925135688 2:1523977-1523999 TGCAGAGAGTAGGGGGGATTTGG - Intronic
925135694 2:1524006-1524028 TGCACAGAGTGGGGGGGATTTGG - Intronic
925135716 2:1524092-1524114 TGCACGGAGTGGGGGGAATTTGG - Intronic
925135783 2:1524376-1524398 TGCACAGAGTGGGGGGGATTTGG - Intronic
925136626 2:1527760-1527782 TGCACAGAGTGGGGGGGATTTGG - Intronic
925136966 2:1529184-1529206 TGCACAGAGTGGGGGGGATTTGG - Intronic
925137184 2:1530025-1530047 TGCAGAGAGTGGGGGTGATTTGG - Intronic
925137604 2:1531706-1531728 TGCAGAGAGTGGGGGGGATTTGG - Intronic
925137614 2:1531735-1531757 TACAGAGAGTGGGGGTGATTTGG - Intronic
925137622 2:1531764-1531786 TGCAGAGAGTGGGGGTGATTTGG - Intronic
925137630 2:1531793-1531815 TGCAGAGAGTGGGGGTGATTTGG - Intronic
925137638 2:1531822-1531844 TGCAGAGAGTGGGGGTGATTTGG - Intronic
925138517 2:1535433-1535455 TGCACAGAGTGGGGGGGATTTGG - Intronic
925138997 2:1537279-1537301 TGCAGAGGGTGGGGGGGATTTGG - Intronic
926292772 2:11543898-11543920 ACCGGGGAGTGGGGAGGAGTTGG + Intronic
927256311 2:21043734-21043756 TCCAGGGCGAGTGGGGGGATTGG - Intronic
929815263 2:45225578-45225600 TCCAGGGGGTGGGGTGGGAGTGG - Intergenic
930194534 2:48496166-48496188 TTTAGGGAGTGGGTGGGAGTGGG + Intronic
930391081 2:50762484-50762506 TAGAGGGAGAGGGAGGGAATGGG - Intronic
931245992 2:60493412-60493434 TCCAGGGAATGGGGTGGGAGGGG - Intronic
931246110 2:60493995-60494017 TACGGGGAGTGGAGGGGAAGTGG + Intronic
931265931 2:60660559-60660581 TTCAGGGAGTGGCAGGTAATAGG + Intergenic
931635737 2:64339340-64339362 GCCAGGCAGTCGGGGTGAATAGG + Intergenic
932010716 2:67975005-67975027 GCCAGGGACTGGGTGGGAAAGGG - Intergenic
932901831 2:75710565-75710587 TCCAGGGAGACGCGGGGAAGCGG - Intronic
933135867 2:78734423-78734445 AGCGGGGAGTGGGGGGAAATTGG + Intergenic
933540105 2:83629333-83629355 GCTAGGGGGTTGGGGGGAATGGG - Intergenic
934188143 2:89763976-89763998 CCCAGGGAGTGGGAGGGATAGGG + Intergenic
934308463 2:91843978-91844000 CCCAGGGAGTGGGAGGGACAGGG - Intergenic
934752543 2:96802816-96802838 TCCGGGGAGTCGGTGGGAATAGG + Intronic
934769213 2:96897194-96897216 TCCAGGGAGTGGGGGGGAATAGG - Intronic
934849623 2:97689615-97689637 CCCAGGCAGGGAGGGGGAATGGG + Intergenic
935309471 2:101769439-101769461 TAACGGGAGTGGGGGAGAATGGG + Intronic
935724797 2:106014198-106014220 GCCAGGGGGTGAGGGGAAATGGG - Intergenic
936850196 2:116886834-116886856 GTCAGGGAGTGGGGGGCAAGGGG + Intergenic
937915220 2:127095613-127095635 TCCAGGGAGTGGGAAGGAGGTGG - Intronic
938676777 2:133643898-133643920 TTCAGGCAGGGCGGGGGAATTGG - Intergenic
938904528 2:135825760-135825782 TCCGGGGAGAGGGTGGGAATGGG + Intronic
939304693 2:140395926-140395948 TGAAGTGAGTGGGGGGGAAGGGG + Intronic
939424696 2:142019811-142019833 TCCAGGGAGAGGGAGTGACTTGG - Intronic
940206915 2:151213176-151213198 TCCAGGGAAGAGGGGGAAATGGG + Intergenic
942742206 2:179194088-179194110 TCCAGCTAGTTGGGGAGAATGGG - Intronic
942743552 2:179206672-179206694 TCCAGGGAGTAGGGGGCAAATGG + Intronic
943731553 2:191308016-191308038 TCCAGGGAGGGGAGGGGAGCTGG - Intronic
944231007 2:197392755-197392777 TACAGGCAGTGGGGGGAAAGGGG + Intronic
945780480 2:214165622-214165644 TCAAGGGGGTGGGGGGCAGTGGG - Intronic
947109061 2:226699038-226699060 CCCAAGGAGGGGAGGGGAATAGG + Intergenic
947733190 2:232442173-232442195 TCCCGGGAGTGGGGGAGACTGGG - Intergenic
947935721 2:234001847-234001869 TGCAGTGAGTGAGGGGGACTGGG + Intronic
948126419 2:235567666-235567688 TCTAGGGAGTGGTGGGGAGAAGG + Intronic
948393954 2:237631141-237631163 TCAAGGAAGTGGGAGGGAGTGGG + Intronic
949043340 2:241859249-241859271 CCCAGGGAGATGGGGGGGATGGG - Intergenic
949055858 2:241928009-241928031 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949055945 2:241928335-241928357 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056008 2:241928572-241928594 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056031 2:241928661-241928683 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056064 2:241928778-241928800 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056093 2:241928895-241928917 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056102 2:241928924-241928946 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056122 2:241928982-241929004 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056135 2:241929041-241929063 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056158 2:241929128-241929150 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056179 2:241929188-241929210 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056192 2:241929247-241929269 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056223 2:241929363-241929385 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056239 2:241929421-241929443 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
1169429163 20:5521175-5521197 TCCAGTTAGTGGGGAGGCATTGG - Intergenic
1169809354 20:9593566-9593588 TCCGGGGAGTGGGGGTCAAGAGG - Intronic
1169931495 20:10837780-10837802 TCCAGGGAGGGGAGAGGAATTGG + Intergenic
1170285528 20:14704294-14704316 TCCAGGCAGTGGGCTGTAATGGG + Intronic
1170696019 20:18659749-18659771 GTCAGGGAGTGGGGGGAAAAGGG + Intronic
1170800019 20:19583154-19583176 TGGAGGAAGTGGCGGGGAATTGG + Intronic
1170893438 20:20394786-20394808 TCCAGGGTGTGGGGCAGCATGGG + Intronic
1171251813 20:23654593-23654615 GCAAGGGAGTGGGGAGGACTTGG + Intergenic
1171377372 20:24702657-24702679 GCCAGGGAGTGGGGCGGGGTGGG + Intergenic
1172278192 20:33692333-33692355 TCCAAGGAGTGGGGCGAAACCGG + Intergenic
1172437107 20:34937093-34937115 TCCAGGAGGTGGGGCGGTATGGG - Intronic
1172900232 20:38329341-38329363 GCCAGGGAGAGGGCGGGACTGGG - Intronic
1172934349 20:38609134-38609156 TCCAGGGAGTAGTGGGTAGTGGG + Intronic
1173830731 20:46085490-46085512 TGGAGGGGGTGGGGGTGAATGGG + Intronic
1175192376 20:57219992-57220014 TCCAGGGAAAGGGAGGGAAAGGG + Intronic
1176085446 20:63293643-63293665 TCCAGGGACTTGGGGGCACTCGG + Intronic
1176103475 20:63375087-63375109 TGCAGGGAGTGGGGGAGCCTGGG - Intronic
1176245739 20:64095595-64095617 TTCAGGCAGTGGGGGGTTATGGG + Intronic
1176372833 21:6072852-6072874 TCCAGGGAGAGGAGGGGTAAGGG - Intergenic
1178105203 21:29310792-29310814 TCCACGGAGTGGAGGGGAAAAGG + Intronic
1179750644 21:43465391-43465413 TCCAGGGAGAGGAGGGGTAAGGG + Intergenic
1180535552 22:16391058-16391080 CCCAGGGAGTGGGAGGGACAGGG - Intergenic
1180694872 22:17745301-17745323 GCCAAGGAGTTGGGGGGAGTTGG - Intronic
1181174298 22:21027175-21027197 TCTAGGGAATGGGGTGGAGTAGG + Exonic
1181312360 22:21952347-21952369 TGCAGGGACTGGGGGGATATGGG + Intronic
1181410984 22:22719512-22719534 TCCAGAGGGTGGGGGGTTATTGG + Intergenic
1181496693 22:23291262-23291284 ACCAGGGATTGTTGGGGAATGGG + Intronic
1182067705 22:27442357-27442379 TGCTGGGAATGGGGGGGAAAGGG - Intergenic
1182123988 22:27803347-27803369 TGCCGGGGGTGGGGGGAAATGGG + Intergenic
1182652870 22:31866193-31866215 GCCAGAAAGTGGGGGGAAATTGG + Intronic
1183034915 22:35134244-35134266 TCCAAGGAGTGGGTGGGACTGGG - Intergenic
1183078683 22:35442618-35442640 TCCAGAGGGTGGGAGGGAATCGG - Intergenic
1183310867 22:37108867-37108889 TCCTGAGAGTGTGGGGGACTGGG + Intronic
1183687979 22:39372941-39372963 ACCAGGGAGTGGGGGAGAAGAGG + Intronic
1183904717 22:41031857-41031879 GCTAGGGACTGGAGGGGAATGGG - Intergenic
1183936001 22:41262761-41262783 TCCAGGGAATCTGGGAGAATGGG - Intronic
1184493194 22:44822288-44822310 TGCAGGGAGGGAGGGGGAGTTGG - Intronic
1184891299 22:47381171-47381193 GCCAGGGAGAGGGGGGGAGCCGG + Intergenic
1184968311 22:47997244-47997266 TCCTGGGTGTGGGGGGGAGGGGG - Intergenic
1184979991 22:48089343-48089365 TCCTAGGAGTGGGAGGGAAAGGG - Intergenic
1185244999 22:49768790-49768812 TCCCGAGAGTGGGGGGGCAGGGG + Intergenic
1185332454 22:50257859-50257881 TCCAGCGGGTGGGGGAGAAGCGG - Intronic
949162487 3:896857-896879 TTTAGGGGGTGGGGGGCAATTGG - Intergenic
949260563 3:2099044-2099066 TCGCGGGTGTGGGGGGGAAAGGG + Intronic
949265612 3:2153109-2153131 TCCAGGGAGTGAAGTGAAATAGG + Intronic
951135047 3:19095697-19095719 GTCAGGGAGTGGGGGGCAAAGGG - Intergenic
951765169 3:26189865-26189887 TTCAGGGGGTGGGGGGCAAGGGG - Intergenic
952416635 3:33096393-33096415 TCCAGGTTGAGGGGGGGAATAGG - Intronic
952710708 3:36429456-36429478 ACCTGGGAGTGGTGGGGAACAGG + Intronic
952899175 3:38098252-38098274 TCCAGAGAGTGGGGAGGAGGTGG - Intronic
953296083 3:41718584-41718606 TGTAGGGAGTTGGGGGGAATGGG - Intronic
954497915 3:50982868-50982890 TCCACTGAGTGGGAGGGAGTGGG + Intronic
954717230 3:52532957-52532979 TCCAGGGGGCGGGGGTGACTTGG + Intronic
955524666 3:59808088-59808110 GCCAGGGACTGGGGGGGTAGGGG - Intronic
956259089 3:67317316-67317338 GCCAGGGAGCGGGGCAGAATAGG + Intergenic
956284430 3:67593840-67593862 TCCAGGGAGAGATGAGGAATTGG - Intronic
957020248 3:75118492-75118514 TCCAGGAAGTCAGTGGGAATTGG - Intergenic
958731767 3:97967551-97967573 TACAGGGAGTGGGAAGGAAGAGG - Exonic
959546886 3:107606923-107606945 ACCAGAGAGTGGGGGGAAGTGGG - Intronic
962750205 3:138429245-138429267 TGGAGGGTGTGGAGGGGAATGGG + Intergenic
963004855 3:140717356-140717378 AGCAGGGAGGTGGGGGGAATGGG + Intergenic
963031818 3:140986285-140986307 CCCAGGGAGTGGGGGTCAAGGGG - Intergenic
963377928 3:144494080-144494102 TCCACGGAGTGGGATGGAGTAGG + Intergenic
963458257 3:145574216-145574238 TCCAGTTAGTGGGGAGGTATTGG + Intergenic
963522804 3:146377124-146377146 ACCAGGCAGTGGGAGGCAATTGG - Intergenic
963852413 3:150221719-150221741 TCCAGGGAGCGGGGGCGAGAGGG + Intergenic
964151546 3:153531688-153531710 GCCAGGGAGTTGGGGAGGATTGG - Intergenic
964277623 3:155024876-155024898 TGCAGGAAGTAGAGGGGAATTGG + Intronic
965800659 3:172490615-172490637 GTCAGGGAGTGGGGGGCAAGGGG - Intergenic
966198160 3:177334341-177334363 TCTTAGGAGTGGGAGGGAATGGG + Intergenic
966988184 3:185201455-185201477 TCCATGGAGTGTGGGAGAAGCGG + Intronic
967332620 3:188306669-188306691 TGCAGTGCGTGGTGGGGAATGGG + Intronic
967390352 3:188948522-188948544 TTAAGGGAGTGGGGGTGAGTAGG + Intronic
968578071 4:1377125-1377147 TCCAGAGAGCGGGGGGGCAGGGG + Intronic
969164270 4:5292936-5292958 GTCAGGGAGTAGGGGGCAATGGG - Intronic
969488159 4:7483743-7483765 TCCAGGGGGTGGGGGGCCAGGGG + Intronic
969691910 4:8708592-8708614 TGCAGGGCGTGGTGGGGCATGGG - Intergenic
970284618 4:14496179-14496201 TCAAGGGAGTGGAGGGGAGGTGG + Intergenic
970423564 4:15926769-15926791 TCCAGGGAGTGGGGATAAGTAGG + Intergenic
970760261 4:19476974-19476996 TCCATGGACTGGGGGGTAAGGGG - Intergenic
971184061 4:24356885-24356907 CCCAGGGTATGGAGGGGAATTGG - Intergenic
971873998 4:32280744-32280766 TTCTGGGGGTGGGGGGGAAGGGG + Intergenic
972701070 4:41493950-41493972 TCCAGGGACTGAGGGAGAAGAGG - Intronic
972919394 4:43919649-43919671 GTCAGGGAGTGGGGGGCAAGAGG - Intergenic
973002069 4:44963420-44963442 TTCAGTGAGTGGGAGGGAGTGGG + Intergenic
974354444 4:60794464-60794486 TCCGGGGAGTCGGGGGGAGGTGG - Intergenic
975584932 4:75940328-75940350 TCCCGGGAGTGGGGGGAAGGGGG + Intronic
976086056 4:81408410-81408432 TCCAAGGAGAGGGGAGGAAATGG + Intergenic
976239918 4:82944195-82944217 TCCAGGGAGAGTGGAGGAATGGG - Intronic
978564454 4:110066912-110066934 GGCAGGGGGTGGGGGGCAATGGG - Intronic
978692572 4:111532928-111532950 GTCAGGGAGTGGGGGGCAAGGGG - Intergenic
981545043 4:145884938-145884960 TCCAGGGCCTGTGGGGGAAGAGG + Intronic
981931251 4:150191368-150191390 TCCAGGGAGTGGTGGAAGATAGG + Intronic
982987142 4:162223780-162223802 TCTGGGGAGTGGGAGGGATTGGG + Intergenic
983853696 4:172615477-172615499 TCCAGGGAGTAAGGGGGCAATGG - Intronic
984104311 4:175526067-175526089 TCCAGGGAATGGTGGGGAGAAGG - Intergenic
984163850 4:176285296-176285318 TGCAGGGAGTGTGGGGAAAGGGG - Intergenic
984398858 4:179235800-179235822 TGGAGGGAGTGGGGGAGAAGGGG - Intergenic
984706072 4:182848168-182848190 TCCTGGGCGTGGGGTGGAAGGGG - Intergenic
984934037 4:184874289-184874311 TCCAGGCAGTTGGGGGACATTGG + Intergenic
985117441 4:186605564-186605586 TGGAGGGAGGGGGGAGGAATGGG + Intronic
985962883 5:3316204-3316226 TCTAGGGAGAGGGGGGGAATTGG + Intergenic
986044971 5:4028067-4028089 TCCAGTGAGTGGGAAGGAAAGGG + Intergenic
986118873 5:4811526-4811548 GTCAGGGAGTGGGGGGCAAGGGG - Intergenic
986444677 5:7811077-7811099 TCCAGGTTGTTGGGGGAAATGGG - Intronic
988060338 5:26159326-26159348 TGCAGGGGGTGGGTGGGAAAGGG + Intergenic
991657085 5:68914847-68914869 GCCAGGGAGTGGGGGGGTGGAGG - Intergenic
991950568 5:71943483-71943505 TCCTGGGAATGGGAGGGACTAGG - Intergenic
994371979 5:98977898-98977920 GCAAGGGAGTGAGGTGGAATGGG - Intergenic
994884368 5:105540637-105540659 TCCAGATACTGGGAGGGAATGGG + Intergenic
996304570 5:122032386-122032408 TACAGGGGGCGGGCGGGAATGGG - Intronic
996499558 5:124202223-124202245 TCCAGGGTGTGGGGGTGATATGG + Intergenic
997211978 5:132082180-132082202 GCCAGGGACTGGAAGGGAATTGG + Intergenic
997301277 5:132807483-132807505 TCCAGGGACTTGAGGGGGATGGG - Intergenic
997751229 5:136347815-136347837 TCCAGGCAGTGGAGAGGAATAGG - Intronic
997978467 5:138454173-138454195 TCCAGGGGGTGCTGGGGAAAGGG - Intergenic
998840103 5:146244528-146244550 TAAAGGGGGTGGGGGGGCATGGG - Intronic
999063188 5:148656857-148656879 TCCAGGGAGTCCGTGGGCATTGG - Intronic
999275567 5:150327662-150327684 TCCAGGGAGAGGGAAGGAAGAGG + Intronic
999655708 5:153808388-153808410 GGCGGGGAGTGGGGGGGAGTAGG + Intronic
1000821034 5:165983542-165983564 ACCAGGGACTTGGTGGGAATGGG - Intergenic
1001268720 5:170294748-170294770 TACAGGCAGTGGGGGGTAAGTGG + Intronic
1001349327 5:170942205-170942227 TCCACGGACTGGGGAGGAAGGGG - Intronic
1001604157 5:172948145-172948167 CCCAGGGAGTGGAGAGGACTGGG - Intronic
1002016538 5:176328370-176328392 TACAGAGAGTGGGTGGGAATGGG + Intronic
1002561342 5:180084249-180084271 TCCAGGGAGGGGTGGGGAGCTGG + Intergenic
1003311314 6:4972008-4972030 TGGAGGGAGTGGGGGGGACATGG + Intergenic
1005120200 6:22380817-22380839 ACCAGGGAGTGGGGTGGGCTTGG + Intergenic
1005700705 6:28398054-28398076 TCCAGAGAGTGGGGAGGAGGTGG - Exonic
1006296341 6:33171694-33171716 CCCAGTGAGTGTGGGGGTATTGG - Exonic
1006345732 6:33480894-33480916 TTCAGGGAGGGGGAGGAAATGGG - Intergenic
1006912675 6:37573888-37573910 GCCAGGGAGTGGTGGGGGATGGG - Intergenic
1007979358 6:46134846-46134868 GCCAGGGGTTGGGGGGGAAATGG - Intronic
1011099782 6:83708704-83708726 TCCAGGGCGGGCGGGGGACTGGG - Intronic
1012599259 6:101074101-101074123 ACTAGGCAGTAGGGGGGAATTGG + Intergenic
1014259104 6:119195640-119195662 TCCAGGGGCTGGGGTGGACTGGG - Intronic
1014454145 6:121617404-121617426 TTCAGGGTTTGGGGGAGAATTGG - Intergenic
1015148342 6:130012595-130012617 GCCAGGGAGTGGCCAGGAATCGG + Intergenic
1015305000 6:131697418-131697440 TCCAGGGTGGGGGCGGGAAGGGG + Intronic
1015408443 6:132864089-132864111 AACAGGAAGTGGGGGTGAATGGG - Intergenic
1015910490 6:138163911-138163933 TCCATGGATTGGGGGAGAATTGG + Intronic
1016383149 6:143506145-143506167 TCCAGGGATGGGATGGGAATAGG - Intronic
1017297770 6:152818434-152818456 GTCAGGGAGTGGGGGGCAAGGGG + Intergenic
1019156158 6:170040191-170040213 TGCAGGGGGTGGAAGGGAATGGG - Intergenic
1019415466 7:924778-924800 GCCAGGGAGTGGGAGGAACTTGG + Intronic
1020382728 7:7564810-7564832 TCAAGGGAGAGAGGGGGAAGTGG + Intergenic
1022473272 7:30694585-30694607 GCCAGGGACCGGAGGGGAATGGG + Intronic
1022570674 7:31450355-31450377 TCCAGGGAAGAGGGGGGAAGTGG - Intergenic
1024122718 7:46261085-46261107 TCCAGGGAATGGAGGAGAGTAGG - Intergenic
1025780384 7:64596435-64596457 TCGGGGGAGTCGGGGGCAATGGG - Intergenic
1026107362 7:67431802-67431824 TTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1027218287 7:76198211-76198233 CCCTGGGAGTGGGGGGGGTTGGG - Intergenic
1028998010 7:97123140-97123162 TTCAGGGGGTGGGGGGAAAGAGG - Intronic
1029153574 7:98499048-98499070 TCCAGGGAGAGGGGGAGTTTAGG - Intergenic
1029158157 7:98532003-98532025 ACAAGGGAGTGGTGGGGCATGGG - Intergenic
1029161047 7:98552121-98552143 TCCAGGGAGGGGAGGGGGATTGG + Intergenic
1029706893 7:102280872-102280894 TCCAGGGAGGGGGTGGGTAGGGG - Intronic
1030016695 7:105229799-105229821 GGCAGTGGGTGGGGGGGAATGGG + Intronic
1030937559 7:115603947-115603969 TCCTGGGAATGGGGTGGGATGGG - Intergenic
1031330618 7:120459184-120459206 TTCAGGGAATGAGGGGGAAGTGG - Intronic
1031392517 7:121232725-121232747 CCCAGGGAAAGGGGAGGAATTGG + Intronic
1031947623 7:127858127-127858149 TCTAGGGAGTGTGGGGGTGTGGG + Intronic
1032028125 7:128459781-128459803 TGCAGGGGGTGGGGGGTAATGGG - Intergenic
1032307966 7:130754672-130754694 ACCAGGAAGTGGGGGGCTATTGG - Intergenic
1032446581 7:131989380-131989402 TGCTGGGAGAGGGGGGAAATGGG + Intergenic
1032540297 7:132697352-132697374 ACCAGGGAGTGGAGGGGCAGGGG + Intronic
1032803766 7:135336738-135336760 TGCAGGGAGTGAGGAGGAGTGGG + Intergenic
1033492334 7:141855571-141855593 TGCAGGGAGTGGGGAGTAACAGG + Intergenic
1034097292 7:148421638-148421660 TCCAGGGTGTGGGGGGCATGGGG - Intergenic
1034179391 7:149126100-149126122 TCCAGGGAGTGGGGCGGCCGGGG - Intronic
1034260914 7:149754922-149754944 TCCTGGTATTGGGAGGGAATGGG - Intergenic
1034882415 7:154772596-154772618 ACCGGGGAGTTGGGTGGAATGGG + Intronic
1034944126 7:155250991-155251013 TGGAGGCAGTGAGGGGGAATTGG - Intergenic
1035057437 7:156045384-156045406 TCCAGGGAGTGGAGGAGCAGAGG - Intergenic
1037463635 8:19137951-19137973 TCCAGGGACTGGGGCGGGTTGGG - Intergenic
1037476541 8:19263354-19263376 TCAAGGGAGAGGGTGGGAAGGGG - Intergenic
1037582989 8:20256770-20256792 TCCAGGGAGTGATGGAGAGTAGG + Intronic
1037816412 8:22115003-22115025 TCCAGGGAGGGAGGGGGACATGG - Exonic
1037894452 8:22642401-22642423 TCTGGGGAGTGGAGGGGTATAGG + Intronic
1039458977 8:37727577-37727599 TTCAGGGAGTTGGGGGGAGGTGG - Intergenic
1040468917 8:47719857-47719879 CCCTGGGTGTGGGGGGGCATGGG - Intronic
1041117521 8:54554518-54554540 GCCAGGGAGTCGGGGAGAAAGGG - Intergenic
1041428270 8:57748266-57748288 TGCTGGGAGTTTGGGGGAATGGG - Intergenic
1041457517 8:58076484-58076506 TCCTGGGAGTGGTGGGGACGTGG - Intronic
1043532967 8:81171181-81171203 GTCAGGGAGTGGGGGGCAAGGGG + Intergenic
1043724419 8:83591214-83591236 TGCTGGGAGTGGGGGAGAAGTGG + Intergenic
1043871075 8:85433690-85433712 ACCAGGGAGTGGGGAGAAAGTGG + Intronic
1044384957 8:91577198-91577220 TCCAGGCAGTGGGATGGATTTGG - Intergenic
1045737861 8:105318263-105318285 TCCAGGCGGTGGTGGGGGATGGG - Intronic
1046375680 8:113377009-113377031 TCTAGGGAGTGGGGTGGGGTGGG + Intronic
1047419573 8:124695938-124695960 TCCCGGGAGGGGCGGGGAAGTGG + Intronic
1047448568 8:124942056-124942078 TCCAGAGAGAGGGTGGAAATTGG - Intergenic
1047611332 8:126523670-126523692 TCTGGGGAGTTGGGGGGAAATGG - Intergenic
1048207852 8:132430013-132430035 CCCAGGGTGTGGGAGGGAGTAGG - Intronic
1048941528 8:139404480-139404502 TCCAGGGAGCCGGGGAGAAATGG + Intergenic
1049222673 8:141435071-141435093 GCCAGGGAGTGGGGGAGACCAGG - Intergenic
1049230327 8:141478456-141478478 TCCAGGGTGGGGTGGGGCATGGG + Intergenic
1049451457 8:142664299-142664321 TCCAGGGTGTGGGGAGAAACAGG + Intronic
1049623711 8:143610874-143610896 TCCAGGGAGTCTGTGGGAAGGGG - Intergenic
1049939579 9:532528-532550 TGGAGGGAGTGGAGGGAAATGGG - Intronic
1050202724 9:3163351-3163373 TAAAGTGAGTGGGTGGGAATGGG - Intergenic
1051324216 9:15947352-15947374 TCTAGGGAGATGGGGGAAATGGG - Intronic
1051720903 9:20036484-20036506 ACTGGGTAGTGGGGGGGAATGGG - Intergenic
1051784372 9:20725780-20725802 TTCAGGGAGTGGCTGGGAAAGGG + Intronic
1051912488 9:22170345-22170367 TCCTGGTAATGGGTGGGAATGGG + Intergenic
1052143496 9:25019733-25019755 GTCAGGGAGTGGGGGGCAAGGGG - Intergenic
1052494600 9:29211887-29211909 TCAAGGGAGGCGGGGGAAATTGG + Intergenic
1054923257 9:70562917-70562939 TCCAGGGAGGGGAGAGAAATTGG - Intronic
1055056667 9:72030234-72030256 TGGAGGGAGTGGGAGGGAATAGG + Intergenic
1056581916 9:87894774-87894796 CACCGGGAGTGGGGGGAAATTGG + Intergenic
1056765347 9:89441621-89441643 GCCATGGGGTGGTGGGGAATTGG - Intronic
1057146354 9:92761761-92761783 TCCAGGGAGAGGAAGGGAAAGGG + Intronic
1057686190 9:97237324-97237346 TCCAGGGATGGGGGCAGAATGGG - Intergenic
1057902286 9:98958819-98958841 TCCAGAGAATGGAGGGGACTTGG - Intronic
1058111096 9:101030953-101030975 AGCAGGGGGTGGGGGGGAATTGG + Intronic
1058432071 9:104928353-104928375 TCTAGGGAGTTGGGGGGAGGTGG + Intergenic
1058541004 9:106012658-106012680 TCTAGGGAGGAGGGGGGAAGAGG - Intergenic
1058684319 9:107466824-107466846 TCCAGGGAGTAGTTGGAAATTGG - Intergenic
1058700616 9:107597212-107597234 GCCAGGGACTGGGGGAGAAGGGG - Intergenic
1059110208 9:111550457-111550479 GCCATGGAGTGGGTGGGGATGGG + Intronic
1061246354 9:129402885-129402907 AACAGGGTGGGGGGGGGAATCGG + Intergenic
1061265197 9:129500719-129500741 TTCAGGCCGTGGGAGGGAATGGG - Intergenic
1061361346 9:130144286-130144308 GCCAGGGAGTGGGAGAGACTGGG - Intergenic
1061916681 9:133759238-133759260 TGCAGGGAGTGGGGAGGGGTGGG - Intergenic
1203703290 Un_KI270742v1:13736-13758 TCCGGGGGGGGGGGGGGAAGAGG - Intergenic
1186901965 X:14066202-14066224 TCCAGGGCGTGGGTAGGGATGGG - Intergenic
1187575934 X:20555238-20555260 TTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1187943471 X:24403807-24403829 GCCAGGGACTGGGAGGAAATGGG - Intergenic
1190264304 X:48818195-48818217 GCCAGGGAGGGGGTGGGAAGCGG - Intronic
1190764715 X:53466275-53466297 TCCTGGAAGTGGGGTGGCATAGG + Intergenic
1191653140 X:63563922-63563944 GCCAGGGGGTGGGGGCAAATGGG - Intergenic
1192723384 X:73723807-73723829 GTCAGGGGGTGGGGGGCAATGGG + Intergenic
1193438221 X:81506372-81506394 GCCTGGGAGTGAGGGGGATTGGG + Intergenic
1193639357 X:83992937-83992959 TCCAGGGACTGTGGGGGCAGGGG + Intergenic
1193660175 X:84247874-84247896 TCAAAGGGGTGGGGGGGAAGTGG + Intergenic
1195648027 X:107254564-107254586 TTCAGAGAGTGGGGGGGCTTAGG - Intergenic
1195848690 X:109258108-109258130 TAAAGGGAGTGGGAGGGCATGGG - Intergenic
1196730642 X:118938170-118938192 TCCAGGAGGTGGGGGAGCATGGG - Intergenic
1198807985 X:140508115-140508137 TCTAGGAAGGGCGGGGGAATGGG - Intergenic
1198820713 X:140645283-140645305 GCAAGGGAGTGGTGGGGAGTAGG + Intergenic
1199629838 X:149769870-149769892 ACCAGGGAGTGGGGGGGGGGCGG + Intergenic
1199918478 X:152370853-152370875 TCCGTGGAGTGGGGTGGAATGGG - Intronic
1200111688 X:153743906-153743928 CCCAGGGAGTGGGAGGGACAGGG - Exonic
1201291027 Y:12421044-12421066 TGCAGGGCGTGGAGGGGATTCGG - Intergenic