ID: 934769541

View in Genome Browser
Species Human (GRCh38)
Location 2:96899100-96899122
Sequence CCCTGGGCTTGCAGTGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 549
Summary {0: 1, 1: 1, 2: 5, 3: 74, 4: 468}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934769535_934769541 7 Left 934769535 2:96899070-96899092 CCTGAAGACCTGGGAGGAGGCTG 0: 1
1: 0
2: 8
3: 46
4: 376
Right 934769541 2:96899100-96899122 CCCTGGGCTTGCAGTGGAGATGG 0: 1
1: 1
2: 5
3: 74
4: 468
934769532_934769541 15 Left 934769532 2:96899062-96899084 CCTGGCAGCCTGAAGACCTGGGA 0: 1
1: 0
2: 2
3: 38
4: 373
Right 934769541 2:96899100-96899122 CCCTGGGCTTGCAGTGGAGATGG 0: 1
1: 1
2: 5
3: 74
4: 468
934769536_934769541 -1 Left 934769536 2:96899078-96899100 CCTGGGAGGAGGCTGTGAGCAGC 0: 1
1: 0
2: 6
3: 40
4: 553
Right 934769541 2:96899100-96899122 CCCTGGGCTTGCAGTGGAGATGG 0: 1
1: 1
2: 5
3: 74
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934769541 Original CRISPR CCCTGGGCTTGCAGTGGAGA TGG Intronic
900012805 1:131377-131399 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
900042869 1:487364-487386 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
900064306 1:722361-722383 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
900341262 1:2190430-2190452 CCCTGGGCATCCAGTGGGGCCGG + Intronic
900731435 1:4263895-4263917 CCCTGGGGTCTCAGTGCAGATGG + Intergenic
900806176 1:4769670-4769692 CCCGGGGCCTGCAGTCGAGGAGG + Intronic
901431251 1:9216358-9216380 TCCTAGGCTTACAGTGGAGAAGG - Intergenic
901454389 1:9354819-9354841 TCCTGGGCTACCAGTGGAGAGGG + Intronic
901841595 1:11957280-11957302 CCCTGGGGTGACAGTGCAGATGG - Intronic
902455994 1:16534492-16534514 CCCTGAGCTTACAGTGGACTCGG + Intergenic
902618820 1:17638728-17638750 TGCTGGGCTTCCAGTGGAGCAGG + Intronic
902634808 1:17728318-17728340 CCCACTGCTTGGAGTGGAGAGGG - Intergenic
902676965 1:18015491-18015513 CCCTGGGTTCTCAGAGGAGAGGG + Intergenic
902754034 1:18537487-18537509 CACTGGGCTTTCAGTGGATGGGG - Intergenic
902777346 1:18683132-18683154 CTCTGGGGGTGCAGGGGAGATGG - Intronic
902928739 1:19715691-19715713 CCCTGGGCTGGGATTGGAGGAGG + Intronic
903224346 1:21886377-21886399 CCCGGGGCTTGCTGTGGAGTGGG + Intronic
904196650 1:28790643-28790665 ACACGGGCTTTCAGTGGAGACGG + Intergenic
904675292 1:32195408-32195430 CAGTGGGCTTGCATTGGGGATGG + Exonic
905745529 1:40414081-40414103 CCGTGGCTTTACAGTGGAGATGG + Intronic
906191465 1:43902012-43902034 CCTTGGGCTTGGGGTGGAGAAGG - Intronic
906258605 1:44369062-44369084 CCCTGCGCTAGCACTGGAGGTGG - Intergenic
906319694 1:44808414-44808436 CCCTGGGCCTGCCCGGGAGATGG + Intergenic
906514667 1:46431876-46431898 CCCAGGGCCTGGCGTGGAGAAGG - Intergenic
906567344 1:46810722-46810744 CCCTGGGAGGGCAGGGGAGAAGG - Intronic
906654867 1:47540765-47540787 CACAGGGCTGGCAGTGCAGAAGG - Intergenic
907051319 1:51331233-51331255 CACTGGGAATGCAGGGGAGAGGG - Intronic
907529248 1:55076928-55076950 GCCAGGGCCTACAGTGGAGAAGG - Intronic
908255667 1:62301654-62301676 CGCTGGGCTGGCAGTAGAGGCGG - Intronic
909267323 1:73577253-73577275 TCCTGGGCATGAAGTGGAGATGG - Intergenic
909419770 1:75450719-75450741 GCCTGGGCATGGGGTGGAGAGGG - Intronic
910269186 1:85374511-85374533 CCCTGGACTTGAAGTGAAAAAGG + Intronic
912040433 1:105383376-105383398 GCCTGGGCATGGAGTAGAGAGGG + Intergenic
912759823 1:112356922-112356944 CCCTGTGCTTGGAGAGGGGAGGG + Intergenic
913281189 1:117186658-117186680 ATCTGGACTTGAAGTGGAGAGGG - Intronic
913661356 1:121008770-121008792 CCCTGAGCTTACAGTGGACGCGG + Intergenic
913996034 1:143652467-143652489 CTCTGAGCTTACAGTGGACAGGG + Intergenic
914012723 1:143791950-143791972 CCCTGAGCTTACAGTGGACGCGG + Intergenic
914165107 1:145169234-145169256 CCCTGAGCTTACAGTGGACGCGG - Intergenic
914193644 1:145431944-145431966 CCCTGAGCTTACAGTGGACGAGG + Intergenic
914376787 1:147079470-147079492 CCCTGAGCTTACAGTGGACGCGG - Intergenic
914474972 1:148014834-148014856 CCCTGAGCTTACAGTGGACGAGG + Intergenic
914651348 1:149700559-149700581 CCCTGAGCTTACAGTGGACGCGG + Intergenic
914830966 1:151170633-151170655 GCCTGGTGATGCAGTGGAGATGG - Exonic
914913865 1:151806357-151806379 CCCTGCTCTTGTTGTGGAGAAGG - Intronic
914948480 1:152088248-152088270 AGCAGGGGTTGCAGTGGAGATGG - Intronic
915141763 1:153772453-153772475 CCCTCGGCGTCCAGTGTAGACGG + Intronic
915312790 1:155012702-155012724 CCCTGGCCTTGCAATGAAGAGGG + Intronic
915339373 1:155167841-155167863 CCCTAGGCTGGGAGTGGAGGCGG - Intergenic
915444616 1:155967616-155967638 CCCTGGGCCTGGAAGGGAGAAGG - Intronic
915487262 1:156230442-156230464 CCCAGAGCTTCCAGTAGAGAAGG - Intronic
915584535 1:156837229-156837251 CCCTGGGCATATAGTGCAGAAGG - Intronic
915981630 1:160424046-160424068 CCCTAGGCTTGTAGTGGCGGTGG + Exonic
916944111 1:169707416-169707438 CCCTGGTCATGCAGTGGCCATGG - Exonic
917732665 1:177891740-177891762 GCCTGGGGGTGGAGTGGAGAGGG - Intergenic
917732708 1:177891965-177891987 GCCTGGGCATGAAGTGGAAAGGG - Intergenic
919882897 1:201912447-201912469 CCCTGATCCTGCAGGGGAGATGG - Intronic
920048009 1:203146050-203146072 CCCTGGGCTCCCAGAGGAGCTGG - Intronic
920313857 1:205064389-205064411 CCCGGGGCTGGCAGGGGATAAGG - Exonic
920816553 1:209339669-209339691 CCCTGAGCTTACAGTGAACATGG - Intergenic
921056986 1:211549761-211549783 TGCTGGGCTGGGAGTGGAGATGG - Intergenic
921187799 1:212684902-212684924 CCCTGAGTTAGCAGTGGAGTAGG + Intergenic
921440665 1:215182314-215182336 GCCTAGGGTTGGAGTGGAGAGGG + Intronic
921440685 1:215182427-215182449 CCCTGGGGTTTCAGTGGAAAGGG + Intronic
922003508 1:221504529-221504551 ACCTGGGCATGGAGGGGAGAGGG - Intergenic
922099206 1:222468373-222468395 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
922261243 1:223947867-223947889 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
922465002 1:225840370-225840392 CTCTGGGGCTGCAGGGGAGAGGG + Intronic
922735829 1:227977873-227977895 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
922801897 1:228368272-228368294 GGCTGGGCTTAAAGTGGAGAGGG + Intronic
922898491 1:229118783-229118805 ACCTGAGCTTGAAGTTGAGAGGG - Intergenic
924342410 1:243050047-243050069 CCCTGGGCTTTCAGGGCAGATGG - Intergenic
1062849106 10:729252-729274 CCCTCTGTGTGCAGTGGAGATGG - Intergenic
1063181718 10:3607383-3607405 GCCTGGGCCTGGAGTGGAAAGGG - Intergenic
1065341656 10:24712284-24712306 ACTTGGGCATGCAGTGGAGAAGG + Intronic
1065743645 10:28818884-28818906 CCTTGGGCTGGCAGAGGAGATGG - Intergenic
1065935243 10:30515310-30515332 CCATGGGCTTACTGTGGAGGAGG + Intergenic
1066734067 10:38455508-38455530 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
1067041557 10:42955788-42955810 ACCTGGGCTTGCTTAGGAGAAGG - Intergenic
1067202504 10:44185510-44185532 CCTTGGCATGGCAGTGGAGATGG + Intergenic
1068433629 10:56963429-56963451 GTCTGGGCATACAGTGGAGAGGG - Intergenic
1068708259 10:60101737-60101759 CCCTGGGCTTGCTGGTGATAAGG + Intronic
1068945959 10:62729133-62729155 TGCTGGGCTTGCAGGGAAGATGG - Intergenic
1069500718 10:68950634-68950656 CCTAGGGATTGAAGTGGAGATGG + Intergenic
1069891176 10:71653281-71653303 CCCTGGGCTGGCCGTGTTGAAGG + Intronic
1070501942 10:77080613-77080635 CCCTTGGAATGCATTGGAGATGG + Intronic
1070758413 10:79007834-79007856 CCCTGGGCATGGAGTGGAATAGG + Intergenic
1070964110 10:80519046-80519068 CCCTGGGCTTGCAGTGGGGAGGG - Exonic
1072623051 10:97093211-97093233 CCCTGGGAGGGCAGTGGATAGGG + Intronic
1072892919 10:99340993-99341015 CCTAGGGCTTGCAGTCGAGTAGG + Intronic
1073200696 10:101732800-101732822 CCCAGGGTTTGAAGTGGGGAGGG - Intergenic
1074421027 10:113309128-113309150 CCCTGGGCCTGCAGGGATGAAGG + Intergenic
1075742690 10:124705485-124705507 CCCAGGGCTTGTAGAGGAGCAGG - Intronic
1075965198 10:126605309-126605331 CCCTGTGCTTGCATTGGGGTCGG - Intronic
1076023024 10:127089678-127089700 CCCTGGGCAGGGCGTGGAGATGG + Intronic
1076099293 10:127761947-127761969 CGGTGGGCTTGCAGCAGAGAAGG - Intergenic
1076540920 10:131214245-131214267 GGCAGGGCGTGCAGTGGAGATGG - Intronic
1076727366 10:132419862-132419884 CCCAGGGTTTGTCGTGGAGAGGG + Intergenic
1076745067 10:132508883-132508905 CCCTGGACTTGCCATGGAGAAGG - Intergenic
1076804711 10:132849662-132849684 CCCTGGGCTGAGAGTGAAGAAGG + Intronic
1076969141 11:123581-123603 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
1077269076 11:1666581-1666603 GCCTGGGTTGGCGGTGGAGATGG - Intergenic
1077271471 11:1684133-1684155 GCCTGGGTTGGCGGTGGAGATGG + Intergenic
1077503015 11:2917681-2917703 ACCTGGGCATGCAGTGGCGGAGG - Intronic
1077760019 11:5084737-5084759 CCATGGTCTTGGAGTGGTGATGG + Intergenic
1078758548 11:14233697-14233719 CCCTGGGATGGCAGTGGGGATGG + Intronic
1078989553 11:16632792-16632814 GCCTAGGCGTGGAGTGGAGAGGG + Intronic
1078989596 11:16633018-16633040 GCCTGGGCATGAAGTGGAGAGGG + Intronic
1079043300 11:17078298-17078320 CGCTGGGCTCGCCGGGGAGAAGG + Intronic
1079350031 11:19684658-19684680 CACTGGGCTTGCAGTGTGGGGGG - Intronic
1080740898 11:35063440-35063462 CCAGGGGATAGCAGTGGAGATGG + Intergenic
1080895086 11:36442185-36442207 GCCTGGCCATGCAGTGAAGAAGG - Intronic
1081021016 11:37947779-37947801 CCCTGGCCTGGCAGTGGCAAGGG + Intergenic
1081574434 11:44310326-44310348 CCCTCGGCTAGCTGTGGGGAGGG - Intergenic
1082948702 11:58788197-58788219 GCCTGGGCAAGGAGTGGAGAGGG - Intergenic
1083295328 11:61712307-61712329 CCCTGGGGTTGTAGTGAGGATGG + Intronic
1083739391 11:64700591-64700613 ACCTAGGATTGCAGTGGAGAAGG - Intronic
1084236761 11:67792708-67792730 CCCTGGGCTTACAGTGCAGCAGG - Intergenic
1084438940 11:69159721-69159743 CCCTGGGCTGCCGGTGGAGGTGG - Intergenic
1084980124 11:72824552-72824574 CCCAGGGGTTGGTGTGGAGACGG - Intronic
1085023411 11:73222814-73222836 CCCTGGGCTTGCCTTGGTTATGG + Intronic
1085260185 11:75200146-75200168 CCAAGGGCTTGCAGCGGGGAAGG - Intronic
1086229201 11:84548197-84548219 CTCAGTGCTGGCAGTGGAGAAGG - Intronic
1086499554 11:87437903-87437925 ACCTGGGCTGGCAGTGGAAGGGG + Intergenic
1086583561 11:88426488-88426510 CCAAGGGGTTGCAGTGGAAAGGG - Intergenic
1087562076 11:99802960-99802982 GCCTAGGCATGGAGTGGAGAGGG + Intronic
1089565868 11:119371338-119371360 TGCTGGGCTTGGAGTGGAGCAGG - Intronic
1089661795 11:119990839-119990861 CCCTGGGCACCCAGTGGGGAGGG + Intergenic
1089783903 11:120894541-120894563 CCCAGGGGTTGCAGTGAAGGAGG - Intronic
1090228559 11:125085856-125085878 CCGTGGACTGGCAGTGGAGAAGG - Intronic
1090736870 11:129618111-129618133 CCAGGGGCTTGCGGTGGAGCAGG - Intergenic
1091721507 12:2817333-2817355 CCCTGGGCCTGGAGGGGGGAAGG + Intronic
1092392155 12:8090229-8090251 TCCTGGTATTGCTGTGGAGACGG + Exonic
1092525380 12:9306515-9306537 ACCTGGGCAAGCAGTGGAGGTGG + Intergenic
1092541892 12:9425302-9425324 ACCTGGGCAAGCAGTGGAGGTGG - Intergenic
1094511119 12:31097137-31097159 ACCTGGGCAAGCAGTGGAGGTGG + Intronic
1095968130 12:47883073-47883095 CCCTGGGCTGTGAGAGGAGAAGG - Intronic
1096519747 12:52178208-52178230 TCCTGAGCCTGCTGTGGAGAAGG - Intronic
1096615635 12:52831699-52831721 CCCTGGCCTTGGAGGGGAGGTGG - Intronic
1096737822 12:53669724-53669746 CCATGGGCTTTAGGTGGAGATGG - Intronic
1099479121 12:83144347-83144369 TCCTGGGCTTCCAGAGGTGAGGG - Intergenic
1100931904 12:99619226-99619248 GCCTGGGCATGGTGTGGAGAGGG - Intronic
1102551112 12:113692896-113692918 CCCTGCGCTTGCTTTGGAGGAGG + Intergenic
1102651698 12:114447104-114447126 CCCTGAGCTTCTGGTGGAGAAGG + Intergenic
1102929218 12:116849712-116849734 TCCTTGACTTGGAGTGGAGAAGG - Exonic
1102945965 12:116988355-116988377 CCCTGGGCTGGAAGTGAAGGAGG - Intronic
1103949975 12:124545268-124545290 CCCTGGGCCTGCTGCGGAGGTGG - Intronic
1105498737 13:20953164-20953186 AGCTGGGCCTGCAGTGGAGGAGG + Intergenic
1106934345 13:34701879-34701901 CCCTGTGAGTGAAGTGGAGAGGG - Intergenic
1107158543 13:37198196-37198218 GCCTGGGGGTGGAGTGGAGAGGG + Intergenic
1107297097 13:38921265-38921287 GCCTGGGCATGAAGTAGAGAGGG + Intergenic
1108640523 13:52378750-52378772 CCCTGGGGCTGAAGAGGAGATGG + Exonic
1109154511 13:58889751-58889773 CCCGGTGGTTGTAGTGGAGAGGG + Intergenic
1110256106 13:73435652-73435674 CACTGGGCTTATAGTGAAGAGGG - Intergenic
1110638233 13:77790998-77791020 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
1110999080 13:82154788-82154810 GCCTGGGCATGCTGGGGAGATGG + Intergenic
1112223280 13:97513324-97513346 GCCTGGGCATGAAGTGGAAAGGG + Intergenic
1115512201 14:34148507-34148529 CACTGGGCTTACAGTGGTGCAGG + Intronic
1117824441 14:59687317-59687339 GCCTAGGCATGGAGTGGAGAGGG - Intronic
1120852017 14:89180108-89180130 TCCGGGGCTGACAGTGGAGATGG + Intronic
1121407170 14:93726109-93726131 CCCTGGGCTTGGAGGGCAGCAGG + Intronic
1121699787 14:95943931-95943953 CACTCAGCTTTCAGTGGAGAAGG - Intergenic
1121822045 14:96978380-96978402 CCTTGGGCTTGGAGTGAAAAGGG - Intergenic
1121977234 14:98416472-98416494 CCCTGGGCCAGCAGTGGATGGGG + Intergenic
1122421714 14:101582046-101582068 CCTTGGGCTTGGTGTGGAGCAGG - Intergenic
1122869797 14:104633063-104633085 CCCTTGCTTTGCAGTGTAGAGGG + Intergenic
1124005523 15:25792762-25792784 CCCTGCCCTGGCAGGGGAGATGG - Intronic
1124121735 15:26894071-26894093 CCCTTGGCTTTCAGTGCAAAGGG - Intronic
1125319848 15:38474400-38474422 GCCTGGGCATGTAGTTGAGATGG - Intronic
1125383852 15:39115458-39115480 GCCTGAGCATGGAGTGGAGAGGG - Intergenic
1128760001 15:70210144-70210166 CCCAGGGCTTTCAGTGCAGCAGG + Intergenic
1129035377 15:72645823-72645845 CCCTGGGATTGCAAAGGTGAGGG - Intergenic
1129214507 15:74091393-74091415 CCCTGGGATTGCAAAGGTGAGGG + Intergenic
1129651208 15:77491560-77491582 TTGTGGGCTTCCAGTGGAGAGGG - Intergenic
1130715419 15:86329211-86329233 GCCTGGGAGTGAAGTGGAGAGGG - Intronic
1130715479 15:86329536-86329558 GCCTGGGCATGAAGTGGAGAGGG - Intronic
1131369157 15:91865367-91865389 ACATGGGCTTGGAGGGGAGAGGG + Intronic
1132310502 15:100854138-100854160 CCCCGGGCCCACAGTGGAGAGGG + Intergenic
1132575170 16:660772-660794 TCCTGGCCTTGGGGTGGAGACGG - Intronic
1133348375 16:5085251-5085273 CCCTGGGCTTACGGTGCAGCAGG - Exonic
1134016959 16:10895469-10895491 CCCTCAGCTTGCTGTAGAGACGG + Intronic
1134265591 16:12690142-12690164 ACCTGGGCTTGAACTGGTGAGGG + Intronic
1135548955 16:23383912-23383934 CCCTGGGATTGCTGTGCTGAGGG - Intergenic
1136139068 16:28277117-28277139 CAAGGGGCTTGCAGAGGAGAGGG + Intergenic
1136686361 16:31997018-31997040 CCCTGAGCATGCAGTGAAGGAGG - Intergenic
1136786973 16:32940547-32940569 CCCTGAGCATGCAGTGAAGGAGG - Intergenic
1136882799 16:33913242-33913264 CCCTGAGCATGCAGTGAAGGAGG + Intergenic
1137564445 16:49524553-49524575 CCCTGGGCCTGGCATGGAGAAGG + Intronic
1137676515 16:50306312-50306334 CCCTGGGCTGGCCGTTGTGACGG - Intronic
1137892185 16:52174398-52174420 CCCTGAGCCTGCAGTGCTGAGGG - Intergenic
1138337438 16:56264165-56264187 ACCTGGGGTTGCAGTGTTGATGG + Intronic
1138565352 16:57828780-57828802 GGCTGGGCTTGTAGTGGAGAGGG - Intronic
1139342618 16:66278346-66278368 GCCTGGGTGTGGAGTGGAGAGGG - Intergenic
1139467784 16:67163442-67163464 CCCTGGGCTGGCAGTGGAGCTGG + Exonic
1140410066 16:74736061-74736083 CCCTGGGAGGGCAGTGGACAGGG - Intronic
1141210307 16:81973517-81973539 GCCTGGGCATGGAGCGGAGAGGG - Intergenic
1141409814 16:83825381-83825403 CACTGGGGTTGCAGTGAAGCAGG + Intergenic
1141560715 16:84866152-84866174 CCCTGGGTTTTCACTGGGGAAGG - Intronic
1141750752 16:85956337-85956359 CCCTGTGGTTGTAGTGGAGTGGG - Intergenic
1141826212 16:86482177-86482199 GCCTGGGCCTGCAGGGAAGAGGG + Intergenic
1142451533 16:90175541-90175563 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
1203089210 16_KI270728v1_random:1202217-1202239 CCCTGAGCATGCAGTGAAGGAGG - Intergenic
1144087229 17:11821752-11821774 CCCTGGGTTTGGAGTAGACATGG + Intronic
1145127897 17:20316902-20316924 ACTTGGGCTCCCAGTGGAGAGGG - Intronic
1147147321 17:38492687-38492709 CCCTGAGCATGCAGTGAAGGAGG - Intronic
1148617063 17:49008987-49009009 CCCTGATCTTACAGTGCAGATGG + Intronic
1149020768 17:51961942-51961964 GCTTGGGCATGAAGTGGAGAGGG - Intronic
1150505894 17:65698873-65698895 CCCTGGGCTTGCACTGAAGAGGG - Intronic
1150901423 17:69282300-69282322 TCCTGGGTGAGCAGTGGAGAAGG - Intronic
1151443074 17:74146060-74146082 CCCTGGACACGGAGTGGAGAAGG + Intergenic
1151807112 17:76412629-76412651 ACCTGTGCTGGCAGTGGAGTGGG - Intronic
1152272877 17:79335461-79335483 CCCTCGTCTTACAGTGGAGGAGG + Intronic
1152647896 17:81478359-81478381 TCCTGGGCTTGCATGGGAGGGGG + Intergenic
1154447790 18:14449411-14449433 CCCAGGACATGCAGTGCAGACGG - Intergenic
1156073070 18:33237171-33237193 CACTGGGCTTGGAATGAAGATGG - Intronic
1156426554 18:37019788-37019810 GCCTGGGCATGGAGTGTAGAGGG + Intronic
1156482216 18:37443422-37443444 CCCTGGGCTGGCAGGAGAGGAGG + Intronic
1156886453 18:42141163-42141185 GCCTGGGCATGGAGTGGAAAGGG - Intergenic
1157474888 18:48017134-48017156 CCCTGAGGGTGCTGTGGAGATGG - Intergenic
1157479075 18:48041222-48041244 GACTGGCCTTGCAGTGGACAGGG - Intronic
1157557155 18:48620318-48620340 CCCTGACCTTGGAGGGGAGATGG + Intronic
1157940345 18:51921706-51921728 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
1158797336 18:60863124-60863146 CACTGGGCATGCAGTAGAGGTGG + Intergenic
1159948313 18:74459881-74459903 CCCTGGGCTGGCGCTGCAGATGG - Intergenic
1160440286 18:78884334-78884356 GCCTGGGTGTGGAGTGGAGAGGG - Intergenic
1160645947 19:193507-193529 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
1161248857 19:3270069-3270091 TCCTGGGCCTGCACTGAAGATGG - Intronic
1161607077 19:5221073-5221095 CGCTGGGCTTGCCGTTGAGCAGG + Exonic
1161857282 19:6773100-6773122 CTCTGGGCCTGCAAAGGAGAGGG + Intronic
1162087093 19:8255503-8255525 ATGTGGGCCTGCAGTGGAGAGGG + Intronic
1162105305 19:8366519-8366541 CCACTGGCTTGCAGAGGAGAAGG - Intronic
1163318360 19:16556797-16556819 CTCTTGGAGTGCAGTGGAGATGG - Intronic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164014690 19:21242954-21242976 CTCTGGGTTTGTAGTGGAGTTGG - Intronic
1164031276 19:21408001-21408023 CTCTGGGTTTGTAGTGGAGTGGG + Intronic
1164134431 19:22400578-22400600 CTATGGGTTTGTAGTGGAGAGGG - Intronic
1164164381 19:22656195-22656217 CTATGGGTTTGTAGTGGAGAGGG + Intronic
1164215071 19:23137758-23137780 CTCTGGGCTTATAGTGGAGAGGG + Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1165101340 19:33440372-33440394 CCCTGGGGTTGGAGTGGATGGGG - Intronic
1165161306 19:33818434-33818456 CCCTGGGCTTACAGAGGCCATGG - Intergenic
1165243488 19:34484344-34484366 CCCTGGGGTTGCAGCCCAGAGGG + Intronic
1165733176 19:38159300-38159322 CCCTGGGCTTGCACCGGAGGTGG + Intronic
1165956251 19:39503694-39503716 CCCTGGCCTTTCAGGGAAGATGG - Intronic
1166235828 19:41455617-41455639 CCGTGGTATTGCAGTAGAGAAGG + Intergenic
1167349922 19:48968199-48968221 CGCTTGGTTTGCAGTTGAGAGGG - Exonic
1168019183 19:53596218-53596240 TCCTGGGATTGCAGCGGAGTTGG - Intergenic
1202706882 1_KI270713v1_random:30848-30870 CCCTGAGCTTACAGTGGACTCGG + Intergenic
925214704 2:2084496-2084518 CCCTGGGCTAGGAGTGGAGAGGG + Intronic
925768447 2:7259712-7259734 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
926699031 2:15790432-15790454 CCCTGGGACTGCAGTGAAGCAGG + Intergenic
926755985 2:16236383-16236405 CTCTTAGGTTGCAGTGGAGAGGG - Intergenic
926790977 2:16571438-16571460 AGCAGGGCTTGCACTGGAGAAGG + Intronic
927510688 2:23642323-23642345 CCCTGTGCCTGCAAGGGAGATGG - Exonic
928197483 2:29225969-29225991 CACTGGGCTCACAGTGGGGAGGG + Intronic
928303753 2:30148027-30148049 CCCTCCGCTTGCAGTCGGGAGGG + Intronic
929205333 2:39285140-39285162 CCCAGTGCTTTCAGTGGAAAAGG - Intronic
930210811 2:48635098-48635120 GCCTGGGCATGGAGTGGAGAGGG + Intronic
931200800 2:60095767-60095789 CCCATGGCTTGCAGTGCGGATGG + Intergenic
931463802 2:62469937-62469959 CCCTGGGACTGGAGTGGGGATGG - Intergenic
932196076 2:69785172-69785194 GCCTGGTCTTGCAGCAGAGAAGG + Intronic
932226375 2:70044360-70044382 CCCTGGGCTAGCAGAAGAGATGG - Intergenic
932612761 2:73211973-73211995 TCCTGGCCTGGCTGTGGAGAAGG + Exonic
932682365 2:73836820-73836842 CCCAGGGGTTGAAGTGGAGATGG - Intronic
933336745 2:80968119-80968141 GCCTGGGCATGGAGTGGAGATGG - Intergenic
934040499 2:88124236-88124258 CCCTGGGCATGCAGGGCAGGTGG + Intronic
934756549 2:96828331-96828353 CCCTGGGCTTCCAGGAGGGAGGG + Intronic
934769541 2:96899100-96899122 CCCTGGGCTTGCAGTGGAGATGG + Intronic
935849612 2:107204486-107204508 CCCTGGGCTGGCAGATGAGAGGG - Intergenic
936023351 2:109012459-109012481 CCCTGGGATTGCAAAGCAGAAGG + Intergenic
936239417 2:110773972-110773994 CCCTGGGATTCCAGTGCAGCTGG + Intronic
936659614 2:114528156-114528178 CCCTGTGCTTGCAGTGTGTATGG - Intronic
937111623 2:119371133-119371155 GCCTGGCCTTGTAGGGGAGAGGG - Intronic
937354854 2:121191921-121191943 CCCTGGGATTGGCTTGGAGAGGG - Intergenic
939024111 2:136991491-136991513 ACCTGGGTATGCAGTGGAGAGGG + Intronic
940408453 2:153332703-153332725 GCCTGGGCATGGAGTGGAGAGGG + Intergenic
941855834 2:170229945-170229967 CCCTGTGCTTACAGTAGAAAGGG + Intronic
943141870 2:183993056-183993078 GCCTTGGTTTGGAGTGGAGAAGG + Intergenic
944046218 2:195414456-195414478 CCATGGGCCTGCAGTGGTGGTGG + Intergenic
944602751 2:201320357-201320379 GCCTGGCTTTGCAGTGGACAGGG + Intronic
945012240 2:205477976-205477998 CCCAGGGCTAGCCTTGGAGAAGG + Intronic
945495012 2:210499238-210499260 GCCTGGGAGTGGAGTGGAGAGGG + Intronic
946192594 2:218015437-218015459 ACCTGGGCTAGTAGTGGTGAAGG - Intergenic
947870859 2:233437179-233437201 CCCTGGCTTTGCACTTGAGAAGG - Intronic
948047173 2:234952928-234952950 CCCGGGGCCTGCGGTGTAGACGG + Intronic
948620814 2:239232916-239232938 CCCTTGGCTTGCTGAGGGGAAGG - Intronic
948711547 2:239828611-239828633 CCCTGGGCTTCCAGCAGGGATGG + Intergenic
948876846 2:240833985-240834007 CCCAGCTCTTGCAGTGGAGCCGG + Intergenic
1169515552 20:6312369-6312391 GCCTGGGCGTGAAGTGGAGAGGG - Intergenic
1170783669 20:19449233-19449255 CCCTGGGAATGCAGGGGAGCTGG - Intronic
1170821311 20:19758063-19758085 TCCTGAGCTCGCAGAGGAGATGG - Intergenic
1170905860 20:20514811-20514833 GCCTGGGCTTGGAGTGCAAAAGG - Intronic
1170913927 20:20604075-20604097 TCGTGGGCTTGCTGGGGAGATGG - Intronic
1172166670 20:32903794-32903816 GCCTGGGCTAGCAGTGGCCATGG + Intronic
1173608954 20:44352501-44352523 CCCTGGTCTTCCAGTTGAGCTGG - Intergenic
1174069196 20:47888071-47888093 GCCTGGCCTTGCAGGGGTGAAGG + Intergenic
1174648259 20:52104223-52104245 CCCTGAGATTCCAGTGGAGGCGG + Intronic
1175498159 20:59429400-59429422 CCCAGGGCGCTCAGTGGAGACGG + Intergenic
1175996763 20:62815427-62815449 CCCTGGGCTTGGGGTGGGGCTGG + Intergenic
1176279559 20:64292709-64292731 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
1176377371 21:6093163-6093185 CCCAGACCATGCAGTGGAGATGG - Intergenic
1178011723 21:28294955-28294977 CCATGGGGTTGCTGTGGAGTTGG - Intergenic
1178434075 21:32541988-32542010 CTCTGGGCTTGCTGTAGTGATGG + Intergenic
1178472774 21:32908743-32908765 CCCTGGGCCTGAAGTGCAGAGGG + Intergenic
1179307783 21:40170411-40170433 CCCTGGACCTGCTGAGGAGAGGG - Intronic
1179746103 21:43445081-43445103 CCCAGACCATGCAGTGGAGATGG + Intergenic
1179989217 21:44938056-44938078 CACTGGGCTGGCAGTGGAAGAGG + Intronic
1179993039 21:44958512-44958534 CCTTGGGCCTGCGGGGGAGAGGG + Intronic
1180817990 22:18804964-18804986 CCCTGGGGTTTCAGTGGTCATGG - Intergenic
1181204208 22:21239419-21239441 CCCTGGGGTTTCAGTGGTCATGG - Intergenic
1181355428 22:22293695-22293717 CCCTGGGCCTGAAGTGGACTTGG - Intergenic
1182115439 22:27753698-27753720 CCCAGGGCTTCCTGGGGAGAAGG + Intronic
1183112007 22:35657294-35657316 ACCAGGGCTTGCAATGGGGAAGG - Intronic
1183519775 22:38290169-38290191 CCCAGGGTCAGCAGTGGAGAGGG + Intergenic
1183726416 22:39592408-39592430 CTCTGGGCTTGCTGTGGAGCTGG + Intronic
1183805884 22:40210626-40210648 CCCTTTGACTGCAGTGGAGACGG + Intronic
1184057179 22:42060406-42060428 TCCTGGGCCTGCAGTGGGGAGGG + Exonic
1184204163 22:42990507-42990529 CCCTGGGCCTGCAGAGTGGATGG - Intronic
1184589934 22:45475396-45475418 GCATGAGCTTGCAGTGGGGAAGG + Intergenic
1203222715 22_KI270731v1_random:55996-56018 CCCTGGGGTTTCAGTGGTCATGG + Intergenic
1203268115 22_KI270734v1_random:30818-30840 CCCTGGGGTTTCAGTGGTCATGG - Intergenic
950034557 3:9876142-9876164 ACCTGGGATTGCAGATGAGAGGG + Intronic
950508166 3:13409035-13409057 CCCTGGACTTACAGGGGAGCTGG - Intronic
951193956 3:19803702-19803724 GCCTGGGGGTGGAGTGGAGAGGG - Intergenic
953665005 3:44918953-44918975 CCCTTGGCTTCCAGAAGAGATGG - Intronic
953996509 3:47523913-47523935 ACCAGGACTTGCAGTGGGGACGG + Intergenic
954103161 3:48393447-48393469 ACCTGGGCTTCTGGTGGAGAGGG + Intronic
954485963 3:50851446-50851468 TCCTGGGCGTGGAGTGGAGAAGG + Intronic
954673360 3:52302538-52302560 CCCTGGGCTGGCTGAGGGGAAGG + Intergenic
954678351 3:52327701-52327723 CCCAGTCCTAGCAGTGGAGAGGG + Intronic
956160069 3:66341996-66342018 CCCTGGGGTTGAATTGGAAAAGG + Intronic
957532501 3:81458570-81458592 CCCAGGCCATTCAGTGGAGATGG + Intergenic
957925490 3:86805397-86805419 CCATGGGCCTGCAGTGCAGGTGG + Intergenic
958636501 3:96753361-96753383 CACTGGGCCCCCAGTGGAGACGG + Intergenic
958790495 3:98645496-98645518 CCCTGGGCTCGAGCTGGAGATGG + Intergenic
959430648 3:106251332-106251354 GCCTGGGCATGAAGTGGAGAAGG - Intergenic
959627479 3:108469169-108469191 CCCAGGGCTTGCAAAGGACAGGG + Intronic
961442344 3:126960507-126960529 CCCTGGCCTGGCAGGGGAGATGG + Intergenic
961563979 3:127750237-127750259 TTCTGGGTTTGCTGTGGAGAAGG + Intronic
961658840 3:128457735-128457757 CGCTGGGCTTGCAGAGCAGGTGG - Intergenic
961886330 3:130098721-130098743 CCCTGGGCTTGTGGTGCAGCAGG - Intronic
962771654 3:138616074-138616096 CCCAGGACTGGCAGTGGAGATGG + Intronic
962786547 3:138773440-138773462 CACTGGTATTTCAGTGGAGAGGG + Intronic
964919182 3:161875339-161875361 GCCTAGGCATGGAGTGGAGAAGG - Intergenic
965836776 3:172861708-172861730 CCCTGGGCTTGACGTGCATATGG - Intergenic
965980250 3:174681437-174681459 CCCTCTGCCTGCAGAGGAGAGGG + Intronic
966128851 3:176611968-176611990 CCCAGGGATTGAAGTGGAGGAGG + Intergenic
966311518 3:178599764-178599786 CCAGGGGCTGGCAGAGGAGAGGG - Intronic
967190662 3:186982080-186982102 CCCTAGGTTAGCAGTGGAGTTGG + Intronic
967334014 3:188322340-188322362 ACCAGGGCATGCAGTGAAGAAGG - Intronic
967518885 3:190404748-190404770 CCCTGGTCTTCCAGTGAAGCTGG + Exonic
968371734 3:198226019-198226041 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
968394654 4:223737-223759 CTCTGGGGTTGCAGAGAAGAAGG + Intergenic
968407002 4:349660-349682 CTCTGGGGTTGCAGAGAAGAAGG + Intronic
968419234 4:468689-468711 CTCTGGGGTTGCAGAGAAGAAGG - Intronic
968765091 4:2463959-2463981 CCTTGGGCCTGCAGAGGAGATGG + Intronic
968995523 4:3942891-3942913 CCCTGGGCTTACTGTGCAGCAGG - Intergenic
969721935 4:8896865-8896887 CCTTGGGCATGCAGGGCAGAAGG + Intergenic
970268662 4:14318882-14318904 ACCTTGGAATGCAGTGGAGAAGG + Intergenic
971240567 4:24885075-24885097 CCCTGGGCTGGCTGTGGTGGAGG + Intronic
971531306 4:27692687-27692709 GCCTGGGCATGCAGTGTAGAGGG + Intergenic
971614066 4:28764638-28764660 GCCTGGGCATGGAGTGAAGAGGG - Intergenic
972557147 4:40193180-40193202 CACTGGGCTTGCAATGGAGGTGG + Intronic
972600243 4:40565714-40565736 CCCTGGGCTTGCTCTGAAGATGG - Intronic
972600408 4:40567004-40567026 CCCTGGGCTTGCTCTGAAGATGG + Intronic
974180650 4:58380067-58380089 TCCTGGGCATGGAGTGGAGAGGG + Intergenic
974785901 4:66619390-66619412 GCCTGGACGTGAAGTGGAGATGG + Intergenic
975276328 4:72505909-72505931 GCCTGGGTGTGGAGTGGAGATGG + Intronic
975710458 4:77156678-77156700 GCCTGGGTGTGCAGCGGAGAAGG - Intergenic
976218748 4:82739273-82739295 TCCTGGCCTGGAAGTGGAGAGGG + Intronic
977764184 4:100777655-100777677 GCCTGGGCATGGAGTAGAGAGGG + Intronic
979260422 4:118638497-118638519 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
979913836 4:126405174-126405196 CTCTGGGCATGGAGTGGGGATGG - Intergenic
981017570 4:139989695-139989717 GCCTTGGCTTTCAGTGAAGAAGG - Intronic
981751093 4:148092818-148092840 CCCTGGGGTCGGAGTGGGGAGGG + Intronic
982099200 4:151952134-151952156 CCCAGGGCTTTCAGCAGAGATGG + Intergenic
982843733 4:160223945-160223967 GCCTGGGTGTGGAGTGGAGAGGG + Intergenic
985897672 5:2758745-2758767 CCCTGGGCTTGGAGAGGAAGTGG - Intergenic
986042684 5:4008758-4008780 GCCTGGGATTGCAGATGAGAAGG - Intergenic
986502825 5:8418010-8418032 TTGTGGGGTTGCAGTGGAGAAGG - Intergenic
987087875 5:14487094-14487116 CCCTGGGGCTGCCGTGGAGGCGG - Intronic
988942000 5:36156257-36156279 GCCTGGGCCTCCAGTGGAGCCGG + Intronic
989413723 5:41149594-41149616 CCCAGGGCTTGGAGTGGGGTGGG - Intronic
990382723 5:55232575-55232597 CGCTGGGCTTAGGGTGGAGAGGG + Intronic
991006394 5:61832374-61832396 CCCTGGACTTCCAGAGAAGATGG - Intergenic
991638800 5:68733183-68733205 ACCAGGGCTTGGAGTGTAGAGGG + Intergenic
991964412 5:72076986-72077008 CCCTGGGCCAGAAGGGGAGAAGG - Intergenic
991977215 5:72195192-72195214 ACCTCGGCTTTCACTGGAGATGG - Exonic
993426265 5:87768282-87768304 CAGTTGGCCTGCAGTGGAGAAGG - Intergenic
993728773 5:91398026-91398048 CCCAGGGCTGGTAGTGGAAAAGG + Intergenic
994399725 5:99264072-99264094 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
994669281 5:102747169-102747191 GCCTGGGGTAGCAGTGCAGAGGG - Intergenic
994824790 5:104699028-104699050 GTCTGGGCTTGAAGTTGAGAGGG - Intergenic
995388725 5:111615854-111615876 CCCTGGGCATGGAGCAGAGAGGG + Intergenic
997059887 5:130488391-130488413 CCATGGGCTGGTAGTGGTGACGG + Intergenic
997518523 5:134507209-134507231 TCCTGGGCTTGGCATGGAGAAGG + Intergenic
997980235 5:138464244-138464266 TCCGGGGCTGGGAGTGGAGAGGG + Intergenic
998038135 5:138933694-138933716 CCCTGGTCTTGCAGAGGAGTAGG + Intronic
999552343 5:152703040-152703062 ACCAGGGCATGCAGAGGAGAAGG + Intergenic
1001699294 5:173695313-173695335 CCCTGGGGTGGCAGTGGTGGAGG - Intergenic
1001940452 5:175736247-175736269 CCTTGGCCTTGCAGAGAAGAAGG - Intergenic
1002730974 5:181331565-181331587 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
1002753559 6:142539-142561 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
1002827288 6:785121-785143 CCCTGGGCTTCTTGTGGAGATGG - Intergenic
1002956082 6:1866083-1866105 CCCTGTGCTTGAGGTGGAAACGG - Intronic
1005994659 6:30923929-30923951 CTCTGGGGTGGCAGTGGAGCGGG - Intronic
1006008900 6:31026021-31026043 CTCAGAGCTTGCAGTGGAGGTGG - Exonic
1006008975 6:31026474-31026496 CTCAGAGCCTGCAGTGGAGACGG - Exonic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1009395849 6:63199700-63199722 AGCTGGTCTTGCACTGGAGAGGG + Intergenic
1009656911 6:66558847-66558869 GCCTGGGCATGGAGTGGAGAGGG + Intergenic
1010475039 6:76276405-76276427 GCCTGGGCATGGAGTAGAGAGGG + Intergenic
1010486821 6:76424691-76424713 CCCTGGGATTTCATTGGAGTTGG + Intergenic
1011957198 6:93037708-93037730 GCCTGGGCATAGAGTGGAGAGGG + Intergenic
1012207304 6:96477615-96477637 CACTGGGCCTGCAGTGGGGTGGG - Intergenic
1013036876 6:106393466-106393488 CCTTGGGCTTGCACTGCAGGGGG + Intergenic
1013174698 6:107667410-107667432 CCCAGGGGATGCAGTGGAGGTGG + Intergenic
1013399898 6:109783102-109783124 ACCAGGGCCTGCAGTGGTGAGGG + Intronic
1013608977 6:111776253-111776275 CCCAGGGGTTGGAGTGGAGCAGG + Intronic
1015306554 6:131715406-131715428 GCCTGGGCATGAAGTGGAGATGG - Intronic
1015350356 6:132210595-132210617 GCCTGGGCATAGAGTGGAGAGGG + Intergenic
1016175671 6:141075256-141075278 ACCTGAGCTTGGAATGGAGAGGG + Intergenic
1017445546 6:154504130-154504152 ACCTGGGCTTGCAGTGAGCATGG - Intronic
1017615983 6:156246921-156246943 CTCTGGGCTTGCTGTAGTGATGG + Intergenic
1017776874 6:157687621-157687643 CCCTGAGCTTGGAGTGGGGGAGG + Intergenic
1019686046 7:2382822-2382844 CCCCGGGCTTGCAGTGGAAAAGG + Intergenic
1019944450 7:4315440-4315462 TCCTTGGCCTGGAGTGGAGAGGG + Intergenic
1020006507 7:4786236-4786258 CCCTGGTCTTGCAGGGGAAGCGG + Exonic
1020089736 7:5332538-5332560 CCCTAGGCTGGGAGGGGAGAGGG + Intronic
1020319790 7:6931197-6931219 CCCTGGGCTTACGGTGCAGCAGG - Intergenic
1021189397 7:17602698-17602720 GCCTGCGCGTGGAGTGGAGAGGG - Intergenic
1021189420 7:17602811-17602833 GCCTGGTCATGGAGTGGAGACGG - Intergenic
1021307035 7:19045280-19045302 GCCTGGTCTTGGAGTGGAGAGGG - Intronic
1021936452 7:25636750-25636772 TCCTGGCCTTGCTGTGGAGGTGG + Intergenic
1022305768 7:29145468-29145490 CACTGGGGTTGCAGTGAAGGTGG + Intronic
1023190865 7:37580823-37580845 GACTGGGCTTGCAGTGGAGGTGG - Intergenic
1023402139 7:39798097-39798119 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
1024076120 7:45818727-45818749 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
1024647484 7:51382563-51382585 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
1025051318 7:55737058-55737080 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
1025060084 7:55798313-55798335 CCCTGGGCTTTCAGGGCAGGTGG - Intronic
1025128283 7:56362725-56362747 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
1025164164 7:56695986-56696008 TTTTGGGCTTGCAGTGGAGATGG - Intergenic
1025176665 7:56805606-56805628 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
1025695127 7:63770780-63770802 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
1025706118 7:63866085-63866107 TTTTGGGCTTGCAGTGGAGATGG + Intergenic
1025755848 7:64339932-64339954 TCTTGGGTATGCAGTGGAGAGGG + Intronic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025804398 7:64816855-64816877 CTCTGGGTTTGTAATGGAGAGGG + Intronic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025854063 7:65263252-65263274 CCCATGGCAGGCAGTGGAGAGGG - Intergenic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1026329132 7:69336893-69336915 CCCAGGGAATGCAGTGGGGATGG - Intergenic
1026933590 7:74238829-74238851 GGCTGGGCTGGCAGTGGGGACGG - Intronic
1027495134 7:78878771-78878793 GCCTGGGCATGGAGTGGAGAAGG - Intronic
1027934899 7:84589614-84589636 CCCTGGGCGTGGAGCAGAGAGGG - Intergenic
1028160972 7:87484137-87484159 CCCTGGGCCTGTGGTGGTGAAGG + Intergenic
1028792849 7:94873271-94873293 CTCTGGGCTGGCAGTGGGCAGGG + Intergenic
1029530364 7:101121469-101121491 CCAGGGGCTGGCAGGGGAGAGGG + Intergenic
1030246307 7:107387428-107387450 CCCTGGGCTTCCTGCGGAGCTGG - Intronic
1031237652 7:119197189-119197211 GCCTGGGCATGAAGTGGAGAAGG - Intergenic
1032052652 7:128658490-128658512 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
1033440320 7:141372567-141372589 CCCTGGGGTTGCAGAAGAAATGG - Intronic
1033679813 7:143583347-143583369 GCCTGGGCAAGAAGTGGAGATGG - Intergenic
1033692022 7:143746096-143746118 GCCTGGGCAAGAAGTGGAGATGG + Intergenic
1033730995 7:144179094-144179116 GCCTGGGCATGAAGTGGAGATGG + Intergenic
1034042687 7:147896237-147896259 CCCTCAGCTTACAGTAGAGAGGG - Intronic
1034857532 7:154565951-154565973 CAATGTGCTTGCAGTGCAGAGGG + Intronic
1036626126 8:10473413-10473435 CCCTGGGCTTAAAGTTCAGAAGG - Intergenic
1036686799 8:10917194-10917216 CCCTGGGCCTGCAGTTGAGCAGG - Intronic
1036760259 8:11503802-11503824 CCCTGGGCTCGCAGTGAAAGGGG + Intronic
1038327071 8:26579366-26579388 CCCTGGGATTTCACTGGGGATGG - Intronic
1038777549 8:30544604-30544626 ACCTGGGCATGCAGTGAAGCGGG - Exonic
1039507706 8:38064007-38064029 GGCTGGCCTAGCAGTGGAGATGG + Intergenic
1039552510 8:38453294-38453316 CCCTGGGCCTCCAGGGGAGACGG - Intronic
1039584400 8:38694057-38694079 CCCTGGGCTGGAACTGCAGAAGG - Intergenic
1039983320 8:42427475-42427497 CCACAGGCTTGCTGTGGAGAGGG + Intronic
1041887669 8:62830635-62830657 GCCTGGGCTTGGAGTGGAGAGGG - Intronic
1042109700 8:65367596-65367618 GCCTGGGCATGGAGTGTAGAGGG - Intergenic
1042366703 8:67945452-67945474 CCAGGGGCTTGCAGTGGGGGAGG + Intergenic
1043213133 8:77550768-77550790 GCCTGGGCATGTATTGGAGAGGG + Intergenic
1043213153 8:77550881-77550903 CCCTGGGCATGGAGTAGAGAGGG + Intergenic
1045727072 8:105186306-105186328 TCCTGGGCACGGAGTGGAGAGGG + Intronic
1045727090 8:105186419-105186441 GCCTGGGGGTGGAGTGGAGATGG + Intronic
1046839456 8:118841168-118841190 CCCTGGGCCTGCAATGGGAAGGG - Intergenic
1048218249 8:132516478-132516500 CCCTCGGCTTGCAGTGGCCAGGG - Intergenic
1049309306 8:141924915-141924937 CCCTGGGCTTCTGGGGGAGAGGG - Intergenic
1049392215 8:142377736-142377758 CTCTGGGGGTGCAGTGAAGAGGG - Intronic
1049594213 8:143475996-143476018 CCCTGGGGCTGCAGGGCAGAGGG + Intronic
1050687695 9:8190461-8190483 GCCTGAGCTTGAAGTGGGGAAGG - Intergenic
1050687714 9:8190574-8190596 TCCTGGGCATGTAGTGTAGAGGG - Intergenic
1051215776 9:14795860-14795882 CCCGGGGCATCCACTGGAGAGGG - Intronic
1053446833 9:38159184-38159206 CCCTTGGTTTGAAGTGGAGTGGG + Intergenic
1056089999 9:83196002-83196024 CCCGGGGGTGGCAGTGGACACGG + Intergenic
1058694713 9:107549433-107549455 GGCTGGCATTGCAGTGGAGAAGG + Intergenic
1059714945 9:116905040-116905062 CCCAAGGCTGGGAGTGGAGAGGG - Intronic
1060268963 9:122127977-122127999 GCCAGGCCTTGCAGTGGGGAGGG + Intergenic
1060415562 9:123427365-123427387 CCCGGGGCTAGGAGAGGAGAAGG - Intronic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1061213138 9:129204852-129204874 GCCAGGGCTGCCAGTGGAGAAGG - Intergenic
1061677723 9:132227838-132227860 CCCTGGGCTGCAAGTGGAGAAGG + Intronic
1061824351 9:133248542-133248564 CCCTGAGAATGCAGTGCAGAAGG + Intergenic
1062350972 9:136138454-136138476 CCCCGGGCTGGCGGTGGAGAGGG + Intergenic
1062389154 9:136327308-136327330 CCCAGGGAATGCAGGGGAGAGGG - Intergenic
1062395143 9:136349822-136349844 CCGTTGGCTGGCAGTGGAGTTGG - Intronic
1062461740 9:136665278-136665300 CTCTGGGCCTGCGGTGGGGACGG + Intronic
1062522515 9:136964128-136964150 CCCAGGCCTGGCAGGGGAGAGGG + Intergenic
1062599251 9:137312587-137312609 CCTTGGGCCTGGAGAGGAGAGGG - Intronic
1062755380 9:138284072-138284094 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
1203760456 EBV:10588-10610 CCCAGGCCTTGCAGGGCAGACGG + Intergenic
1203579293 Un_KI270745v1:28244-28266 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
1185569729 X:1124339-1124361 CCCTGCGTTTGCAGCGAAGATGG - Intergenic
1187317220 X:18207064-18207086 CCCTGGCCTAGCAGTGCAGGGGG + Intronic
1187471530 X:19574015-19574037 GGGTGGGCTTGGAGTGGAGATGG + Intronic
1190117293 X:47634598-47634620 CACTGGGCATGCAAGGGAGAGGG - Intergenic
1191221986 X:57998943-57998965 GCCTGGGCTGGCAGTGGCTATGG + Intergenic
1191774067 X:64793352-64793374 GCTTGGGCATGGAGTGGAGAGGG - Intergenic
1192062208 X:67839105-67839127 CCCTGGGACTGTAGTGGTGATGG + Intergenic
1192219021 X:69184443-69184465 CACTGGGAGTGGAGTGGAGAAGG - Intergenic
1192436370 X:71145854-71145876 CCCTGGAGTTGCCATGGAGACGG + Intronic
1192438149 X:71155144-71155166 CCCTGGGCTGGCAGGGGTGGGGG + Intronic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1193549436 X:82872316-82872338 GCCTGGCTTTGCAGTGGACAGGG - Intergenic
1194157831 X:90415345-90415367 CCATGGGCTTGTAGTGGTGTTGG - Intergenic
1194350421 X:92819720-92819742 TCATGGTCTTGCAGTTGAGAAGG - Intergenic
1194923554 X:99796317-99796339 GCCTGGGCATGGAGTGGAGAGGG + Intergenic
1194923599 X:99796652-99796674 ACCTGGGCATGGAGTAGAGAGGG + Intergenic
1195876010 X:109541317-109541339 ACATGGGTTTCCAGTGGAGATGG + Intronic
1196528142 X:116751001-116751023 GCCTGGGCATGAAGTAGAGAGGG + Intergenic
1197285741 X:124593212-124593234 CCCTGGGCATGCAGCAGAGAGGG + Intronic
1198046502 X:132909015-132909037 ACCTGGGCTTCCAGTGGAGTTGG - Intronic
1198774430 X:140164646-140164668 CCCCTGGGTTGCTGTGGAGAAGG + Intergenic
1198968164 X:142249973-142249995 GCCTGGGCGTGGAGAGGAGAGGG + Intergenic
1199227437 X:145394248-145394270 GCCTGGGCGTGCAGTGGAAAGGG + Intergenic
1200067960 X:153514081-153514103 CCCTGGGCTGCAAGTGGACACGG + Intergenic
1200090538 X:153633891-153633913 CCCTTGGCCTGCAGTGGGCATGG - Intergenic
1200504160 Y:3992314-3992336 CCATGGGCTTGTAGTGGTGTTGG - Intergenic
1200658739 Y:5936357-5936379 TCATGGTCTTGCAGTTGAGAAGG - Intergenic
1201298365 Y:12485243-12485265 ACCTGGGTTTGCAGTGTGGATGG + Intergenic
1201313610 Y:12621254-12621276 CCCTGAGATTGCAGTGCAGTGGG + Intergenic
1202381900 Y:24280866-24280888 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
1202488884 Y:25389259-25389281 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic