ID: 934774379

View in Genome Browser
Species Human (GRCh38)
Location 2:96927799-96927821
Sequence GAGTGTCCCTGTGTCCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 293}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934774379_934774382 6 Left 934774379 2:96927799-96927821 CCCAGGAGGACACAGGGACACTC 0: 1
1: 0
2: 0
3: 17
4: 293
Right 934774382 2:96927828-96927850 GCAGTCACAAGTGGCTCTTCTGG 0: 1
1: 0
2: 0
3: 8
4: 111
934774379_934774383 15 Left 934774379 2:96927799-96927821 CCCAGGAGGACACAGGGACACTC 0: 1
1: 0
2: 0
3: 17
4: 293
Right 934774383 2:96927837-96927859 AGTGGCTCTTCTGGACTCCACGG 0: 1
1: 0
2: 0
3: 15
4: 182
934774379_934774381 -3 Left 934774379 2:96927799-96927821 CCCAGGAGGACACAGGGACACTC 0: 1
1: 0
2: 0
3: 17
4: 293
Right 934774381 2:96927819-96927841 CTCATCACAGCAGTCACAAGTGG 0: 1
1: 0
2: 2
3: 16
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934774379 Original CRISPR GAGTGTCCCTGTGTCCTCCT GGG (reversed) Intronic
900074405 1:801415-801437 GAGTGACCCTGAGCCCTCCCAGG - Intergenic
900103251 1:971708-971730 GCGTGTGCGTGTGTCCTCCAGGG + Intronic
900116332 1:1029242-1029264 GAGTGTGCCTGTGTCCACACGGG + Intronic
900155809 1:1202881-1202903 CAGTGTCCCTGTGCCACCCTTGG + Intergenic
900494358 1:2969719-2969741 GGGTGTCCCAGGGGCCTCCTGGG + Intergenic
900516690 1:3085551-3085573 GAGTGACCCCGGCTCCTCCTGGG + Intronic
900642736 1:3695130-3695152 TAATGTCTCTGTGTCCACCTCGG - Intronic
900787702 1:4659011-4659033 GTGGGGCCCTGTGTGCTCCTGGG + Intronic
900902298 1:5525312-5525334 CACTGTCCATGTGACCTCCTAGG + Intergenic
902549157 1:17208907-17208929 GAATGTCCCTGTCTCCTACAAGG - Intronic
902931435 1:19734437-19734459 CAGTGCCCCCGGGTCCTCCTTGG + Intronic
904379513 1:30101554-30101576 CAGTGAGCCTGGGTCCTCCTAGG + Intergenic
904592452 1:31622531-31622553 GATCGTGCCTGTGTCCTGCTTGG - Intronic
905493174 1:38361331-38361353 AAGTTTTCCTGTGGCCTCCTGGG - Intergenic
906033901 1:42739220-42739242 GATTGTCCCTGGGGGCTCCTGGG + Intronic
912863560 1:113236702-113236724 GAGTGTCCCAGCTTCATCCTTGG + Intergenic
914227470 1:145733039-145733061 CAGTGCCCTTTTGTCCTCCTAGG - Intronic
914332941 1:146689302-146689324 GAGTCTCCCTGTGCACTCCCAGG - Intergenic
915072072 1:153278264-153278286 GAGTGTCCCTGTATCCCTCATGG + Intergenic
915288180 1:154866033-154866055 GAATGTCCCTGAGCTCTCCTGGG + Intronic
915705488 1:157839570-157839592 CAGTGTCCCTGTGTCCTTGGAGG - Intronic
917231412 1:172841779-172841801 CAGTCTCCCTGTGTCATCCTGGG - Intergenic
918133363 1:181647787-181647809 GTGTGTCCCTTTGTCCTACCGGG + Intronic
918281916 1:183015033-183015055 GAGTCTCTCTCTGTCCTCCAGGG - Intergenic
918750781 1:188266489-188266511 GAGGGTCTGTGTGTCCTCTTGGG + Intergenic
919765929 1:201127335-201127357 GAGTGGCCCTCTCTCCTTCTTGG - Intergenic
919853606 1:201690693-201690715 GTGTGTGTCTGTTTCCTCCTTGG + Intronic
919962472 1:202485498-202485520 GAGAGTCCCTCTGTCCTCACAGG - Intronic
920678333 1:208054289-208054311 GAGGGTCCTTTTCTCCTCCTTGG + Intronic
921132008 1:212227895-212227917 GAGTGACACTGTGCCCTCCTGGG + Intergenic
922270252 1:224026319-224026341 GAGTGACCCTGAGCCCTCCCAGG - Intergenic
922983566 1:229849256-229849278 AAGTGGCCCTGTGTCCTCTAGGG - Intergenic
923087821 1:230714478-230714500 GCATGTCCCTGTGGCCTCTTGGG - Intergenic
1062979796 10:1712631-1712653 GAGTCTCCCTCTGTCCCCCAGGG + Intronic
1063413195 10:5852593-5852615 GGCTGTCCCTCTGGCCTCCTTGG + Intergenic
1066454291 10:35559822-35559844 GAGTGAGGCTGTTTCCTCCTTGG + Intronic
1067270872 10:44790307-44790329 CAGTGCCCCTGAGTCCTTCTAGG - Intergenic
1067699306 10:48557272-48557294 CAGAGTCCCTGTGTCATTCTAGG + Intronic
1069242853 10:66163599-66163621 GAGGGTCTCTGGGTCCTCTTGGG + Intronic
1069561091 10:69430191-69430213 GAGTGTCGCTCTGTCCTCCAGGG + Intergenic
1069585964 10:69602554-69602576 GAGTTTACCAGAGTCCTCCTGGG + Intergenic
1072834278 10:98694692-98694714 GAGAGACCCTGTGTCATCTTTGG - Intronic
1073022028 10:100453121-100453143 GAGTCTCCCTGTTGCCACCTGGG - Intergenic
1073858849 10:107712052-107712074 GAGTCTCACTCTGTCATCCTAGG - Intergenic
1075640861 10:124063355-124063377 GAGTGTCACTCTGTCCCCCCAGG - Intronic
1076480257 10:130780115-130780137 GTCTGGCCCTCTGTCCTCCTAGG - Intergenic
1076657102 10:132031938-132031960 GAGTGCCTCTGTGCCCTCCAGGG - Intergenic
1077142187 11:1029543-1029565 CAGTGCCCCTGTGTGCTCCACGG - Exonic
1077413573 11:2414409-2414431 GAGGTTCCCTTTGTCCTGCTGGG - Intronic
1077498101 11:2896464-2896486 GAGAGTCCCTCTGGCCTCCAAGG + Intronic
1078553053 11:12293644-12293666 GAATTTCCCTGGGTGCTCCTTGG - Exonic
1078913830 11:15759098-15759120 CACTGTCCCTGTGTCATCCCGGG - Intergenic
1079009505 11:16816807-16816829 GCGTGGCCCCGTGCCCTCCTTGG + Exonic
1081585654 11:44382067-44382089 GAGTGTCCCTCAGAGCTCCTGGG - Intergenic
1083327039 11:61878130-61878152 GAGTGTCCATCTGTCCTTCTGGG - Intronic
1084894723 11:72257766-72257788 GAATGTCCCCGGGCCCTCCTAGG - Intergenic
1085028984 11:73258330-73258352 TGCTGTCCCTGGGTCCTCCTGGG - Intergenic
1085518749 11:77126163-77126185 CTGTGTCCCTCTGTCCCCCTGGG + Intergenic
1088974094 11:114799525-114799547 GAATCTCTCTGTTTCCTCCTTGG - Intergenic
1090461240 11:126893454-126893476 GGATGCCCCTGTTTCCTCCTGGG + Intronic
1090984051 11:131750265-131750287 TGGTGTCCCTGGATCCTCCTTGG + Intronic
1091649738 12:2301107-2301129 AAGTGTGCCTGTGGCTTCCTGGG - Intronic
1091773197 12:3167357-3167379 TAGTCTCTCTGTGTCCTCATTGG - Intronic
1092068834 12:5616003-5616025 CAGTGTCTCTGAGTCCTTCTGGG - Intronic
1092172212 12:6380980-6381002 GAGTCTCCCTTTATCCTCCTGGG + Intronic
1092526127 12:9311328-9311350 CAGTGCCACTGAGTCCTCCTGGG + Intergenic
1092541152 12:9420455-9420477 CAGTGCCACTGAGTCCTCCTGGG - Intergenic
1093056010 12:14556394-14556416 GAGTTTCCCTCTGTCATCCAGGG + Intronic
1093138698 12:15481325-15481347 GAGTGAGGCTGTGGCCTCCTAGG - Intronic
1094511891 12:31102020-31102042 CAGTGCCACTGAGTCCTCCTGGG + Intronic
1095655840 12:44668379-44668401 GACTGGCCATGTGCCCTCCTGGG + Intronic
1102568226 12:113811157-113811179 CTGTGTCCATGTGTCCTCATTGG + Intergenic
1103643675 12:122373395-122373417 GAGTCTCACTCTGTCCCCCTAGG - Intronic
1103712611 12:122924019-122924041 CAGGGTCCCTGTGGGCTCCTAGG + Intronic
1104798073 12:131533475-131533497 GTGTGCCCCTGAGTGCTCCTGGG - Intergenic
1104806051 12:131590235-131590257 GGGTGTCCCTGTGTGCTTCCTGG - Intergenic
1105965596 13:25381445-25381467 GAGTGGCTCTGAGTCCTGCTAGG + Intronic
1106758143 13:32842762-32842784 GACTGTCTGTGTGGCCTCCTTGG + Intergenic
1107669998 13:42735412-42735434 GACTGTATCTGGGTCCTCCTGGG - Intergenic
1110192752 13:72750171-72750193 AAGTGTCCCTTTCTCCTCTTTGG - Intronic
1112334245 13:98500850-98500872 GAGCATCCCAGTGTTCTCCTGGG - Intronic
1112386204 13:98942262-98942284 GAGTCTCGCTCTGTCCCCCTAGG + Intronic
1112405918 13:99120116-99120138 GAGTCTCTCTCTGTCCCCCTAGG + Intergenic
1113568633 13:111337774-111337796 CAGTTTCCCAGTGTGCTCCTCGG + Intronic
1113757162 13:112820527-112820549 GAGGGTCGCTGTTTCCTCATGGG - Intronic
1114243629 14:20892354-20892376 AAGTGTCTGTGTGTCTTCCTCGG + Intergenic
1115919585 14:38357575-38357597 CAGTGTCCCATTGTCTTCCTTGG - Intergenic
1118689332 14:68323099-68323121 TTTTGTCCCTGTGTTCTCCTTGG - Intronic
1121735171 14:96213378-96213400 GACTGTCCCAGTGTCCTCTGGGG - Intronic
1122425761 14:101604553-101604575 GAGTGGGCCTTTCTCCTCCTTGG + Intergenic
1124464114 15:29920741-29920763 GAGTGGCCCAGTCTCCACCTGGG + Intronic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1125522119 15:40354113-40354135 GTGTGTCCCTGTGTGCTCAAGGG - Intronic
1128721028 15:69948371-69948393 GCCTGTCCCTGGGTCCTCCCGGG - Intergenic
1129117759 15:73374789-73374811 CTGTGTCTCTGTGTCCTTCTGGG + Intergenic
1129737439 15:77974064-77974086 GAGTGTCCCCAAGTGCTCCTGGG - Intergenic
1132585633 16:704903-704925 GAGGGGTCCGGTGTCCTCCTGGG - Intronic
1133129410 16:3667240-3667262 GGGTGTCCCTGTCACCTACTTGG - Intronic
1134824426 16:17273008-17273030 GAGTGTTCCCCTGTCCTGCTGGG - Intronic
1136020965 16:27439821-27439843 GAGGGTCCCTTCCTCCTCCTGGG + Intronic
1136748203 16:32610861-32610883 GAGTCACCCTCTATCCTCCTAGG - Intergenic
1137060191 16:35786620-35786642 GAGTGTCTCAGTGTCCATCTGGG + Intergenic
1137280025 16:46968615-46968637 CAGAGTCCCTGTTTCCTCCATGG + Intronic
1137709231 16:50555064-50555086 GAGTGCCTCTGTGTGGTCCTAGG - Intronic
1137882698 16:52068847-52068869 GGGTGTCCCTATCTCCTTCTCGG - Intronic
1137990441 16:53148603-53148625 GAGTGTCTTCATGTCCTCCTTGG + Intronic
1140000676 16:71021942-71021964 GAGTCTCCCTGTGCACTCCCAGG + Intronic
1140287340 16:73616552-73616574 TATTGTTCCTGTGTTCTCCTGGG + Intergenic
1141118726 16:81334288-81334310 GACTGTGGCTGTGGCCTCCTGGG + Intronic
1141549769 16:84797892-84797914 GAGAGTTCCTGAATCCTCCTAGG - Intergenic
1141705552 16:85662584-85662606 GTGTGTGCCTGTCTCCTCCCAGG + Intronic
1141769805 16:86082936-86082958 CAGGGTCCCTGCCTCCTCCTCGG - Intergenic
1141962058 16:87415583-87415605 GAGTGTCCCCGGCTCCTCCAGGG + Intronic
1142186851 16:88698779-88698801 GAGTGTCCATGAGTCCTTCAGGG - Intronic
1203050338 16_KI270728v1_random:870068-870090 GAGTCACCCTCTATCCTCCTAGG - Intergenic
1142509210 17:384133-384155 GAGGCTCCATATGTCCTCCTGGG - Intronic
1142841525 17:2635114-2635136 GATTGTGCCAGTGCCCTCCTGGG + Intronic
1143016137 17:3892280-3892302 GAGTGTGCCTGTGTCTGCGTGGG - Intronic
1143643939 17:8217455-8217477 GAGTGTCGCTCTGTCCCCCAGGG + Intergenic
1143856018 17:9850105-9850127 GAGAGTACCTGTTTCCTCGTTGG + Intronic
1144874452 17:18390186-18390208 GGGTGTGCCCGTGTTCTCCTGGG + Intergenic
1145746630 17:27324932-27324954 GAGTTTCCCAGCTTCCTCCTTGG - Intergenic
1145797993 17:27667062-27667084 GAGTCACCCTCTGCCCTCCTGGG + Intergenic
1147431141 17:40371522-40371544 GAGTCTCCCTGCTCCCTCCTGGG - Intergenic
1147479438 17:40745248-40745270 CTGTGTTCCTGTGTCCTCCAAGG - Intergenic
1149111719 17:53040499-53040521 GTCTATCCCTGTGTCTTCCTGGG + Intergenic
1150601972 17:66658908-66658930 GTGTGTTCCTGTGTCTTGCTTGG - Intronic
1152226012 17:79093143-79093165 GGGGGTCTCTGGGTCCTCCTGGG + Intronic
1152600943 17:81261852-81261874 CAGTGTCCCCGTGTGCACCTGGG - Intronic
1152859900 17:82690313-82690335 GAGTGTGCATGTGTGTTCCTGGG + Intronic
1152859953 17:82690711-82690733 GAGTGTGCATGTGTGTTCCTGGG + Intronic
1153114608 18:1640101-1640123 GGGTGCTCCTGTGTTCTCCTGGG - Intergenic
1154165093 18:12008824-12008846 GAGTGTGCGTCTGTCCTGCTAGG - Intronic
1154289674 18:13096524-13096546 GTGTGTCCCTTTACCCTCCTGGG - Intronic
1158002479 18:52635943-52635965 GAGGGTCTGTGTGTCCTCTTGGG - Intronic
1159924193 18:74252378-74252400 GTGTGGCTCTGTCTCCTCCTGGG - Exonic
1160283751 18:77518858-77518880 CGATGTCCCTGCGTCCTCCTGGG - Intergenic
1160865916 19:1255875-1255897 AAGTGTCCTTGTGTGCTCCCGGG + Intronic
1160905066 19:1448053-1448075 TGTTGTCCCTGTGTCCCCCTGGG - Intronic
1162163530 19:8737291-8737313 GGGTCTCCCTGTGTTGTCCTGGG - Intergenic
1162524898 19:11201470-11201492 TAGAATCCCTGGGTCCTCCTGGG + Intronic
1162760981 19:12887916-12887938 AAGTGACCCTCTCTCCTCCTGGG + Intergenic
1163294782 19:16405107-16405129 TAGTTTCCCTGTGACCCCCTTGG - Intronic
1164063330 19:21693902-21693924 GAGTGCCCCTTTCCCCTCCTTGG - Intergenic
1164995700 19:32719593-32719615 GAGTGTCCCTGGGGCCTGCAGGG + Intergenic
1165009411 19:32833005-32833027 GCGTGGGCATGTGTCCTCCTGGG + Intronic
1165114030 19:33518279-33518301 GAGTATCCCTGTGCCTTCCCTGG - Intronic
1165397184 19:35570828-35570850 GAGTGACCCTCTGTCCCCCATGG - Intergenic
1166054334 19:40279504-40279526 GGGTGACCCTGGGTCCTCCAGGG + Intronic
1166873360 19:45883779-45883801 CAGTTTCCCTCTGTCCTCCTTGG - Exonic
1167481727 19:49736354-49736376 GAATGTTCCTGTGTACTCCCGGG - Intergenic
1168009661 19:53520360-53520382 GCGTGTCCCCGCGTCCTTCTGGG - Intergenic
1168139187 19:54373810-54373832 GGGTGTCCCTGAGTCATCCTGGG - Intergenic
1168158819 19:54494428-54494450 GGATGTCCCTGAGTCATCCTGGG + Intergenic
1168399723 19:56078302-56078324 CCTTCTCCCTGTGTCCTCCTGGG - Intergenic
1168608158 19:57776386-57776408 TAGTGCCACTGTGTCCTCATGGG - Intronic
1168609801 19:57790117-57790139 TAGTGCCACTGTGTCCTCATGGG - Intronic
1168692687 19:58386430-58386452 GTTTGTCCTTGTGTCCTCCACGG - Intronic
926111874 2:10188836-10188858 GTGTCTTCCTGTGTCCTCCTAGG + Intronic
926631119 2:15137047-15137069 GAGTGTCCCTCAGGCCTCTTTGG - Intergenic
926695413 2:15767150-15767172 GAGTGGCCCAGTGTCCTCATAGG + Intergenic
929587411 2:43125278-43125300 GGCTGTCTCTGTGCCCTCCTGGG - Intergenic
930710187 2:54543442-54543464 GAATGTTCCTGCCTCCTCCTTGG - Intronic
931668599 2:64627347-64627369 GTTTGTCCCTGACTCCTCCTGGG + Intergenic
931684704 2:64783656-64783678 AAGTGGACCTGTTTCCTCCTAGG + Intergenic
932446115 2:71782590-71782612 GAGGCTCCCTGTGTCCCTCTAGG + Intergenic
933693519 2:85197878-85197900 GAGTCTGCCTGTGGCCTCATAGG + Intronic
933994871 2:87660929-87660951 TAGTCTCCCTGTCTTCTCCTGGG + Intergenic
934774379 2:96927799-96927821 GAGTGTCCCTGTGTCCTCCTGGG - Intronic
935637156 2:105258169-105258191 GAGTGGCCTTGTTTCCTCCTGGG - Intergenic
936109542 2:109653630-109653652 GGGTGTCTCTGAGTCCTTCTGGG + Intergenic
936298987 2:111289984-111290006 TAGTCTCCCTGTCTTCTCCTGGG - Intergenic
936531473 2:113279197-113279219 GAGGTTCTCTGGGTCCTCCTGGG + Intergenic
938063613 2:128269760-128269782 GAGGGGCCCTGTGGGCTCCTAGG - Intronic
938208655 2:129445264-129445286 GAGTGTTCCTGTTTCCCCCTGGG + Intergenic
938495806 2:131797499-131797521 CTGTGGCCCTGTGTCCACCTAGG + Intronic
938709081 2:133959854-133959876 GAGGGTCCCTGAGTGCTACTAGG + Intergenic
940153570 2:150629344-150629366 GAGAGGCCCCCTGTCCTCCTTGG + Intergenic
940709523 2:157144699-157144721 GAGGGTCTGTGTGTCCTCTTAGG + Intergenic
940942156 2:159574070-159574092 GGGTCTCACTGTGTCATCCTGGG - Intronic
944621365 2:201518835-201518857 TGGTTTCCCTTTGTCCTCCTAGG + Intronic
945077706 2:206056757-206056779 GAATGTCCCTCTCTCCACCTGGG - Exonic
947654137 2:231811701-231811723 GATTGTACCTGTTTCTTCCTGGG + Intergenic
947921318 2:233877306-233877328 GTCTTTCCCTGTGTGCTCCTTGG + Intergenic
948257283 2:236577579-236577601 GAGTGACCCTGCCTCCTGCTGGG + Intronic
948445972 2:238033084-238033106 GAGTGGCCCTGTCACCTCCCAGG + Intronic
948641656 2:239379182-239379204 GACTCTCCCTCTGTCCTCCGAGG - Intronic
948939975 2:241190730-241190752 GAGAGGCCCTGTGCCCTCCCTGG - Intronic
1168844220 20:932348-932370 GAGTGTCCCTGTGTCTCCTGGGG + Intergenic
1169117168 20:3073010-3073032 GAGCGTGCCAGTGGCCTCCTGGG - Intergenic
1169908955 20:10631433-10631455 GAGTGTCCTGGAGTCCTCCAAGG + Intronic
1170304638 20:14924663-14924685 GAGTCTCCCTGTTTCCCACTTGG - Intronic
1171165467 20:22966797-22966819 GAGGGTCTGTGGGTCCTCCTGGG - Intergenic
1173392128 20:42644692-42644714 GAAAGTCCCTGAGTGCTCCTGGG - Intronic
1173896663 20:46556277-46556299 GTGTGTTCCTGTGTTTTCCTTGG + Intergenic
1174281900 20:49445630-49445652 GAGAGTCCTTGTGGCCTCTTTGG + Intronic
1174997010 20:55581393-55581415 CTGTGTCCCTGTGTTCTCATTGG - Intergenic
1176253314 20:64137589-64137611 CAGCCTCCCTGTGTCCTCCGAGG - Intergenic
1177262560 21:18749847-18749869 GAGTGGCCCTCAGCCCTCCTTGG - Intergenic
1178353252 21:31888335-31888357 TAATGTCCCTGTGTGCTCCCAGG + Intronic
1181604070 22:23969516-23969538 GAGTGTCCCACTGCCCTGCTGGG + Intronic
1181604433 22:23971784-23971806 GAGTGTCCCACTGCCCTGCTGGG - Exonic
1184348247 22:43925943-43925965 GAGCCTCCCTGTGTCCTGCCTGG - Intronic
1184429148 22:44431034-44431056 CAGTGTCCCTGTAACCTCCTGGG + Intergenic
1184450336 22:44578726-44578748 GAGGTTTCCTGTGGCCTCCTGGG + Intergenic
950124565 3:10503503-10503525 CAGTATCCCTCTGTCCTCATCGG + Intronic
951038891 3:17966508-17966530 AAGGGTCTCTGTGTCCTCCATGG + Intronic
951547659 3:23844670-23844692 GAGAATTCCTGTGTCCTCTTAGG + Intronic
953421567 3:42757287-42757309 GCGTGTCCATCTGTCCACCTAGG - Intronic
954449562 3:50564309-50564331 GAGTGTCCATGTATCATCTTAGG + Intronic
954583055 3:51713544-51713566 GAGGGTCTCTGGCTCCTCCTTGG + Intronic
955188449 3:56737429-56737451 GTGTGTCCTGGTGTCCTTCTAGG - Intronic
955750275 3:62179724-62179746 CAGTCTCCCTGTTTCCTTCTTGG + Intronic
955827329 3:62962320-62962342 GAGATTCCCTCTGTCCTCCACGG + Intergenic
956459912 3:69461595-69461617 GAGTCTCACTTTGTCCTCCAGGG - Intronic
960523977 3:118688395-118688417 GATTCTCCCTGTATACTCCTAGG + Intergenic
961360256 3:126362558-126362580 CAGTGTCCATGTGCCCTGCTGGG + Intergenic
961804252 3:129477473-129477495 GAGTGTCCTTTGGTCCCCCTGGG + Intronic
962837737 3:139203869-139203891 GACTGTCCCTGTGTCCCTCATGG + Intronic
962940266 3:140119017-140119039 CCCTTTCCCTGTGTCCTCCTTGG - Intronic
966271478 3:178112379-178112401 GAGTGGCTTGGTGTCCTCCTGGG + Intergenic
967648657 3:191958417-191958439 GAATTTCCCTGGGTCCACCTGGG + Intergenic
968431515 4:561852-561874 GTGTGTCCGTGTGCCCTTCTCGG - Intergenic
968876241 4:3269320-3269342 CTGGGACCCTGTGTCCTCCTGGG - Intronic
969474208 4:7412082-7412104 GAGTGTCCCTACCACCTCCTGGG - Intronic
972200645 4:36710504-36710526 AGGTGTCTCTGTGTCCTCCAGGG + Intergenic
972200651 4:36710551-36710573 GGGTGTCTCTGTGTCCTCCAGGG - Intergenic
973142489 4:46785821-46785843 GAGAGGCCATGTTTCCTCCTAGG - Intronic
975605189 4:76148120-76148142 GAGTACCCCCGTGGCCTCCTCGG + Intronic
976910944 4:90304941-90304963 GAGTGTCACTCTGTCCACCCAGG + Intronic
977419133 4:96775270-96775292 GACTGCCCTTGTGTTCTCCTTGG + Intergenic
977687133 4:99859891-99859913 GAGGCTCCCTGTGCCCTACTTGG + Intronic
978779268 4:112532921-112532943 GAGTCTCACTCTGTCCACCTAGG + Intergenic
980869469 4:138594430-138594452 AAGTTCTCCTGTGTCCTCCTTGG - Intergenic
981337273 4:143581520-143581542 TAGTGGCTCTGTGTCTTCCTGGG + Intronic
984646649 4:182227340-182227362 TAGGGTCCCTGTGACTTCCTGGG + Intronic
985828849 5:2213242-2213264 TAGTGCCACTGTGTCCTCATAGG + Intergenic
985927920 5:3032191-3032213 GAGTCTGCCTGTCTCCTCCACGG - Intergenic
986273905 5:6257067-6257089 CAGTGTCCCTCTGTGGTCCTGGG + Intergenic
987335605 5:16895614-16895636 GGGTGTCTCAGTGTCCTGCTGGG - Intronic
988274204 5:29059584-29059606 GGGTGTCACTCTGTCCCCCTGGG + Intergenic
993252854 5:85550404-85550426 CCGTGTCCCTGTGTCCTCAAGGG + Intergenic
996558385 5:124802181-124802203 CTGTGTCCCTGTGTCCTCAGAGG + Intergenic
996783690 5:127215570-127215592 GAGTGGCTCAGTGTCCTTCTGGG + Intergenic
996913148 5:128679023-128679045 GAGTTTCCCTCTTTCCTCCAGGG + Intronic
999289102 5:150411989-150412011 GAGTGTCACTGTGTCACCCAGGG + Intronic
999507959 5:152218042-152218064 GATCGTCCCTGTGTGGTCCTGGG - Intergenic
999518902 5:152330259-152330281 GAGTCTCACAGTGACCTCCTAGG + Intergenic
999924840 5:156363888-156363910 GAGTTTTTCTGTGTGCTCCTGGG - Intronic
1000184711 5:158847735-158847757 AAGTGTCCGTCTGTCCTTCTTGG + Intronic
1001997817 5:176175901-176175923 GACAGTCACTCTGTCCTCCTAGG - Intergenic
1003234457 6:4283122-4283144 GTGTGTCCCTGTTGCCTCCAGGG - Intergenic
1004774734 6:18830880-18830902 TGGTCTCTCTGTGTCCTCCTCGG - Intergenic
1005214356 6:23508117-23508139 CTGTGTCCATGTGTTCTCCTTGG - Intergenic
1005828176 6:29648980-29649002 TATTTTCCCTGTGCCCTCCTGGG - Intergenic
1005863972 6:29924537-29924559 GAGTCTCCCTCTGTCATCCAGGG - Intergenic
1006418196 6:33917770-33917792 GAGTGGCCCTATGGCCACCTGGG + Intergenic
1008599391 6:53075767-53075789 GAGTGTCACTGTGTCACCCCAGG + Intronic
1013268884 6:108527442-108527464 GAGTGCCCCAGTTTCCTCATGGG - Intergenic
1013479486 6:110541763-110541785 GAGTGGGCCTGTGTCCTGCGTGG - Intergenic
1017190625 6:151649082-151649104 GAGGGTCTGTGGGTCCTCCTGGG + Intergenic
1018100353 6:160432865-160432887 TACTGTCTGTGTGTCCTCCTTGG + Intronic
1018288318 6:162264535-162264557 GGGTGTCCTGGTGCCCTCCTGGG - Intronic
1018689018 6:166328684-166328706 GAAGATCCCTGTGTCCTCCCAGG - Intronic
1018726056 6:166614364-166614386 CTGTGTCCCAGTGTCCTTCTGGG - Intronic
1024325630 7:48107266-48107288 GCTTGTCCCTGTGTCCTTCTGGG + Intronic
1024682805 7:51711389-51711411 CAGTGTCCCTGTGCTATCCTAGG - Intergenic
1026011610 7:66640570-66640592 GATTGTACCTGTCTCTTCCTGGG + Exonic
1031975767 7:128092644-128092666 AAGTGTCCAGGTCTCCTCCTGGG - Intergenic
1032479645 7:132236043-132236065 GAGTGACCCTGTGTGCTACCAGG + Intronic
1032807494 7:135371496-135371518 GTGTGTCCCTGTGTTCTCTATGG - Intronic
1033255553 7:139798338-139798360 GAATCTCCCTGTTTTCTCCTCGG - Intronic
1033539033 7:142339007-142339029 GAGTGTCCCTGTGTCTGCTTGGG + Intergenic
1033669442 7:143477201-143477223 GAGAGCCCCTGTTTCTTCCTGGG - Intergenic
1035541237 8:440064-440086 GAGTGACCCTGAGCCCTCCCAGG + Intronic
1036034459 8:5003990-5004012 CAGTGTCCTTTAGTCCTCCTGGG - Intergenic
1040108881 8:43557036-43557058 GAGTGTCCCTTTCCCCTCCTAGG - Intergenic
1042136106 8:65634340-65634362 TAGTGTTCCTGGGTCCTCATTGG - Intergenic
1042395962 8:68292544-68292566 GAGCCTCCCTGTGTTCTCATGGG + Intergenic
1042943086 8:74127160-74127182 GGGTGTGCCTGTGGCTTCCTGGG + Intergenic
1047889692 8:129293981-129294003 GAGTCTCGCTCTGTCCTCCCAGG - Intergenic
1049446042 8:142632136-142632158 GAGTGCCCCTGGGCCCCCCTGGG - Intergenic
1049606574 8:143532401-143532423 CAGTGTCCCAGTGTCCAGCTGGG - Intronic
1049853315 8:144846075-144846097 GACTGACCCTGCCTCCTCCTGGG + Intronic
1050591571 9:7165535-7165557 GAGTTTCCCAGTGTCCAACTTGG - Intergenic
1052606983 9:30716818-30716840 GAGTCTTCATGTTTCCTCCTGGG - Intergenic
1052618598 9:30875979-30876001 GACTGTGCCTATGTCCTCCATGG - Intergenic
1056781759 9:89555889-89555911 GGGTGTGCCTCTGTCCCCCTGGG + Intergenic
1057214042 9:93218460-93218482 GAGTGCCGATGTGTTCTCCTGGG + Intronic
1057569106 9:96190313-96190335 GAGTGCCCATGTGGCCTCCCTGG + Intergenic
1058294942 9:103294601-103294623 GAGTGTTCCTGACTCCTCCAAGG + Intergenic
1058670909 9:107359765-107359787 GAATGTCCCTGTGGACTTCTTGG + Intergenic
1059064131 9:111064734-111064756 CAGTGTCCTTATGTCCTCCACGG - Intergenic
1060794332 9:126504109-126504131 CCGTGTGCCTGTATCCTCCTGGG - Exonic
1060846716 9:126843077-126843099 GAGTCTCCCTCTGTCCCCCCAGG + Intergenic
1060859623 9:126943965-126943987 GAGGGTCTCTGAGTTCTCCTTGG - Intronic
1061943932 9:133897997-133898019 GAGTGTCCCTAAGCCCTGCTGGG - Intronic
1061958129 9:133974180-133974202 GTATCTGCCTGTGTCCTCCTGGG + Intronic
1062159962 9:135074775-135074797 GAGTCTGTCTGTGTGCTCCTGGG - Intergenic
1062212664 9:135373097-135373119 GTGTGTCCCTGGGTGCTGCTGGG - Intergenic
1062469515 9:136696411-136696433 GAGGGTCCCTGGGGCCCCCTGGG + Intergenic
1203738897 Un_GL000216v2:161865-161887 GGGTGTCCCTGTGTCCCTCTAGG + Intergenic
1187397564 X:18931562-18931584 GAGAGTCCCTATGCCCTTCTGGG + Intronic
1187994276 X:24908433-24908455 CTGTGTCCATGTGTCCTCATTGG + Intronic
1189262880 X:39690163-39690185 GAGTGTCCCAGTGGCTTCCAGGG + Intergenic
1191720105 X:64222313-64222335 GAGTGTCCATGTGCCTTCTTGGG + Intergenic
1196313972 X:114201270-114201292 GAGTGGCCATGTGTCTTCTTTGG - Intergenic
1197659195 X:129151601-129151623 GAGTGTCAGGGTGTGCTCCTTGG - Intergenic
1201283065 Y:12357705-12357727 GAGTGTCCTTTTCCCCTCCTAGG - Intergenic
1202297603 Y:23376437-23376459 GAGAGTCCCTCTGTCCTCAAAGG - Intergenic
1202573206 Y:26294160-26294182 GAGAGTCCCTCTGTCCTCAAAGG + Intergenic