ID: 934776761

View in Genome Browser
Species Human (GRCh38)
Location 2:96943833-96943855
Sequence ACTGATCTGCAGCCTTTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 176}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934776761_934776768 14 Left 934776761 2:96943833-96943855 CCGCCCAAAGGCTGCAGATCAGT 0: 1
1: 0
2: 0
3: 11
4: 176
Right 934776768 2:96943870-96943892 GGAGTCTGCAGATGGGTTCGCGG 0: 1
1: 0
2: 0
3: 11
4: 160
934776761_934776765 -7 Left 934776761 2:96943833-96943855 CCGCCCAAAGGCTGCAGATCAGT 0: 1
1: 0
2: 0
3: 11
4: 176
Right 934776765 2:96943849-96943871 GATCAGTGGTCTGAATTGAATGG 0: 1
1: 0
2: 1
3: 11
4: 118
934776761_934776766 6 Left 934776761 2:96943833-96943855 CCGCCCAAAGGCTGCAGATCAGT 0: 1
1: 0
2: 0
3: 11
4: 176
Right 934776766 2:96943862-96943884 AATTGAATGGAGTCTGCAGATGG 0: 1
1: 0
2: 2
3: 28
4: 465
934776761_934776769 17 Left 934776761 2:96943833-96943855 CCGCCCAAAGGCTGCAGATCAGT 0: 1
1: 0
2: 0
3: 11
4: 176
Right 934776769 2:96943873-96943895 GTCTGCAGATGGGTTCGCGGTGG 0: 1
1: 0
2: 1
3: 2
4: 67
934776761_934776767 7 Left 934776761 2:96943833-96943855 CCGCCCAAAGGCTGCAGATCAGT 0: 1
1: 0
2: 0
3: 11
4: 176
Right 934776767 2:96943863-96943885 ATTGAATGGAGTCTGCAGATGGG 0: 1
1: 0
2: 1
3: 18
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934776761 Original CRISPR ACTGATCTGCAGCCTTTGGG CGG (reversed) Intronic
900297391 1:1958807-1958829 ATTCATCTGCAGCTCTTGGGGGG - Intronic
900981999 1:6051145-6051167 CCTGGTCTTCAGCATTTGGGGGG + Intronic
901791565 1:11655928-11655950 CCTGGTCTGCAGCCTCTGGCGGG + Exonic
901793798 1:11668772-11668794 CCTGGTCTGCAGCCTCTGGCGGG + Exonic
903610223 1:24605953-24605975 AATGTTCTGCAGCTTTTTGGTGG - Exonic
903859261 1:26355150-26355172 TGAGATCTCCAGCCTTTGGGGGG - Intergenic
903971934 1:27124637-27124659 ACAGACCAGCAGCCTCTGGGAGG + Intronic
904581139 1:31545110-31545132 TCTAATTTGCAGGCTTTGGGAGG - Intergenic
904706527 1:32394939-32394961 ACTTAGATGCAGCCTTTGGAGGG + Intergenic
905567575 1:38978027-38978049 ACTGATCAGCAGGATGTGGGTGG - Intergenic
905961929 1:42050221-42050243 ACTGATCTGTGGCCTTGGAGGGG - Intergenic
906209296 1:44003194-44003216 ACTGCTCTGCAGCCTTTCCCAGG + Intronic
908490759 1:64641758-64641780 ACTGAACTGCTGCCTTTAGCTGG + Intronic
910463791 1:87475156-87475178 AGTGATCCTCAGCCTTTGAGGGG + Intergenic
911058002 1:93724112-93724134 ACTGAGCTGCAGCCTGTGCTTGG + Intronic
911166616 1:94730154-94730176 TAAGATCTGCAGCCTTTTGGGGG + Intergenic
912080790 1:105933201-105933223 ACTGATCTACAGCAATTGTGAGG - Intergenic
912231203 1:107794843-107794865 ACTTATCTACATCCTTTGAGAGG - Intronic
917032908 1:170714619-170714641 TCTGCTCTGCATCCTGTGGGAGG - Intronic
917701315 1:177584409-177584431 ACTGATCTGCATGATTTGGATGG - Intergenic
918063276 1:181080764-181080786 AGTGATGTGCAGAATTTGGGCGG + Intergenic
921323352 1:213965817-213965839 ACTGTTCTAAAGCCTTTGGCTGG + Intergenic
921351603 1:214241809-214241831 ACTGATCAGCAGCTTCTTGGGGG + Intergenic
923148013 1:231211218-231211240 AGTGCTCCGCAGCCCTTGGGAGG - Intronic
923326898 1:232888085-232888107 TCTCATCTGGAGCTTTTGGGCGG - Intergenic
923463655 1:234229909-234229931 ATTGATTTCCAGCCTTTTGGGGG - Intronic
923776736 1:236985507-236985529 AAAGATCTTCAGCCTTTTGGCGG - Intergenic
924636477 1:245792758-245792780 CATGATCTGCAGGGTTTGGGTGG + Intronic
1065473721 10:26111281-26111303 GCTCATCTGTAGTCTTTGGGTGG - Intronic
1067308840 10:45093281-45093303 GCTGACCTGCAGCCTCGGGGGGG + Intergenic
1068246506 10:54378034-54378056 ACTAATCTGCAGACTGTGGTGGG - Intronic
1068524907 10:58117288-58117310 ACATATCTCCAGCCTTTGGAGGG + Intergenic
1069973729 10:72196222-72196244 ACTATTCTGCATCTTTTGGGTGG - Intronic
1071030896 10:81179937-81179959 GCTGCTCTGCAGCCTTTGAAAGG - Intergenic
1073192596 10:101662375-101662397 AGTGAGTTGCAGCCTCTGGGGGG - Intronic
1073588611 10:104734753-104734775 ATACATCTGCAGGCTTTGGGTGG + Intronic
1074448183 10:113537705-113537727 ACTTACCTGGAGCCTTTGGGAGG - Intergenic
1074775346 10:116763976-116763998 ACTTCCCTGCAACCTTTGGGGGG + Intergenic
1076267366 10:129119203-129119225 ACTGCACTGCAGCCTGTGTGAGG + Intergenic
1076373965 10:129971553-129971575 GCTGAGCTGCAGCCTTTTGTGGG + Intergenic
1076684329 10:132190277-132190299 ACTGGTCTGTAGTGTTTGGGTGG + Intronic
1077287693 11:1775092-1775114 TCTGGTCTGCAGGCTTTGGAGGG + Intergenic
1077435110 11:2535203-2535225 ACTGGCCTGCAGGCTTTGGGCGG + Intronic
1081833451 11:46134413-46134435 ACTGATCTGGTGACTTTTGGAGG + Intergenic
1084534116 11:69746730-69746752 TTTCATCTGCAGCCTTTGGAGGG + Intergenic
1087366277 11:97223713-97223735 AGTGATCTTGAGCCCTTGGGTGG + Intergenic
1088950768 11:114567469-114567491 GCTGAACGGCAGCCTTGGGGAGG + Intergenic
1093387257 12:18573283-18573305 ACTGAACTATAGCCTTTGTGAGG + Intronic
1094207683 12:27858014-27858036 ACTGATTGGCAGCCATTGTGAGG - Intergenic
1099307927 12:80981587-80981609 ACTGGTCTGCAGCCTGGGGTTGG - Intronic
1104847490 12:131853985-131854007 AGTCCTCTGCATCCTTTGGGAGG + Intergenic
1105290937 13:19053040-19053062 ACTGCACTGCAGCCATGGGGCGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1112624160 13:101083517-101083539 ACTGAAGCACAGCCTTTGGGTGG + Intronic
1115218949 14:31040187-31040209 ACTGCACTCCAGCCTTGGGGAGG - Intronic
1117274470 14:54178825-54178847 ACTTACCTGCTGCCTTTGGACGG + Intergenic
1118009203 14:61592287-61592309 ACTTCCCTGCAGCCTCTGGGAGG - Intronic
1119823912 14:77641633-77641655 CCTGATTTTCAGTCTTTGGGCGG - Intergenic
1122908399 14:104813997-104814019 ACTCTTTTGCAGCCTTTGGGAGG + Intergenic
1123040532 14:105488459-105488481 CCTTCTCTGCAGGCTTTGGGCGG + Exonic
1125311785 15:38387289-38387311 ACTGAGCTTCAGTCTTTGAGAGG + Intergenic
1128043644 15:64597449-64597471 GCTGACCTGCATCCTTGGGGTGG + Intronic
1131873563 15:96783001-96783023 GCAGAGCTGGAGCCTTTGGGCGG - Intergenic
1132866093 16:2093403-2093425 AATGCTCTGCAGCCTTTGCCCGG - Intronic
1133232299 16:4372462-4372484 ACAGATATGCAGCCCTAGGGAGG + Intronic
1133337474 16:5015384-5015406 AGTGGGCTGGAGCCTTTGGGAGG - Exonic
1133787832 16:8986739-8986761 AGTGATCTGCTGGCTTTGGCTGG + Intergenic
1134056801 16:11175185-11175207 ACTGATCTGCAGGCCTAGGGTGG - Intronic
1135460806 16:22641072-22641094 AATGAACTTCAGCCTTTGGAAGG + Intergenic
1137244436 16:46690556-46690578 ACTGATCAGCAGGCTTGAGGTGG - Intronic
1138141395 16:54571650-54571672 ACTGGGCTTCAGCCTTTGGATGG + Intergenic
1139006006 16:62572403-62572425 ACTGAAATGCAGCTTTGGGGTGG - Intergenic
1142346491 16:89557401-89557423 AATGCTCTGCTGCCTCTGGGTGG - Exonic
1143333967 17:6158732-6158754 ACAGCCCTGCAGCATTTGGGAGG + Intergenic
1143677334 17:8444161-8444183 ACTGAACTGCAGCATTTTGGAGG - Intronic
1143885450 17:10061674-10061696 ACAGCTCTGGAGCCTCTGGGGGG + Intronic
1148226966 17:45905909-45905931 GCTGATCTGAAGTCTTTGGTGGG + Intronic
1148671349 17:49412873-49412895 ACTGTGCGGCAGCATTTGGGTGG + Intronic
1149406018 17:56352314-56352336 GCTGACCTGCAGCCTTTGATAGG + Intronic
1149734975 17:58985597-58985619 ACTTATCAGCAGTCCTTGGGAGG - Intronic
1151245559 17:72791882-72791904 ACAGATCTGCAGGGTTGGGGAGG - Intronic
1151293611 17:73167435-73167457 ACTGATCTGCAGTCTTTCCAAGG + Intronic
1152444420 17:80332998-80333020 ACTGATTTACCGCTTTTGGGTGG - Intronic
1155187047 18:23396182-23396204 CCTGATCTGTAGCTTCTGGGAGG - Intronic
1156863403 18:41863889-41863911 ACTCATCTGCAGCATGTGGCAGG + Intergenic
1159525760 18:69586829-69586851 ATTGATGGGCAGCCTGTGGGAGG - Intronic
1159577801 18:70201206-70201228 AATGATCTTCAGCCTCTGGCTGG + Intronic
1160141364 18:76326589-76326611 ACTGATGTGCTCCCTTGGGGTGG + Intergenic
1161191059 19:2956138-2956160 ACTGATCTACAGTATATGGGAGG - Intergenic
1163501357 19:17678439-17678461 ACTGCACTGCAGCCCTTGGGTGG + Intronic
1165720637 19:38077115-38077137 ACTCATCTGCTGCCTCTGGTTGG - Intronic
1167868970 19:52351658-52351680 CCTGCTCTGCAGCCTGTGTGAGG + Intronic
926801742 2:16665624-16665646 ACGCCCCTGCAGCCTTTGGGAGG - Intronic
927108287 2:19846071-19846093 GCTGATTTGCAGCCTGTGAGTGG - Intergenic
927374254 2:22395030-22395052 ACTGAATTGCCGGCTTTGGGGGG + Intergenic
928296811 2:30090835-30090857 ACTGATGTGCATCCTTTGGAAGG - Intergenic
929516884 2:42611554-42611576 ATTGAGATGCAGTCTTTGGGAGG + Intronic
929730330 2:44484114-44484136 AATGATCTGAAGCCATTGGCAGG + Intronic
929882158 2:45846548-45846570 ACTTATCTGCATCATTTGTGAGG - Intronic
933606999 2:84393688-84393710 GCTGCTCTCCAGCCTCTGGGAGG + Intergenic
934776761 2:96943833-96943855 ACTGATCTGCAGCCTTTGGGCGG - Intronic
938747249 2:134291219-134291241 AATGGTCTGGGGCCTTTGGGAGG + Intronic
939615211 2:144354694-144354716 ACTGATTTGCAGGCTTGGAGAGG + Intergenic
940294508 2:152108472-152108494 TCACATCTCCAGCCTTTGGGAGG - Intergenic
946645079 2:221824578-221824600 AATTATATGCAGCCTTTGGCAGG - Intergenic
949027390 2:241772962-241772984 ACTCCTCTGCATCGTTTGGGTGG - Intergenic
1169277695 20:4244610-4244632 ACTGAGCAGCAACTTTTGGGGGG - Intronic
1170593289 20:17787279-17787301 CCTGCCCTGCAGCCTTTGGAGGG - Intergenic
1171384240 20:24757010-24757032 TTTGATCTGCAGCCTTTTTGGGG - Intergenic
1173299016 20:41783973-41783995 ACTGAGCTACAGCATGTGGGAGG + Intergenic
1174552123 20:51369637-51369659 ACCATTTTGCAGCCTTTGGGTGG + Intergenic
1178015256 21:28338551-28338573 ACTGATCTGGTGACTTTGTGGGG + Intergenic
950700376 3:14741167-14741189 ACTGTGCTTCAGCCTTTGTGAGG + Intronic
951034393 3:17917146-17917168 CCTGATATGTAGCATTTGGGTGG - Intronic
951079629 3:18437727-18437749 AGTGATCTCCAGACTGTGGGAGG - Intronic
952510376 3:34047665-34047687 TATGATGTGGAGCCTTTGGGAGG + Intergenic
953237610 3:41120110-41120132 AATTATTTGCAGCCTGTGGGAGG + Intergenic
953366645 3:42351158-42351180 ACCAGTCTGCAGCCTTTGGAAGG - Intergenic
953823737 3:46232442-46232464 ACTGTTCTGCAGCCTGAGGAAGG + Intronic
954525793 3:51270017-51270039 ACAGTTCCACAGCCTTTGGGAGG - Intronic
958528758 3:95296025-95296047 GCTGATCTTTAGCCTGTGGGTGG + Intergenic
961373855 3:126449655-126449677 GCAGGTCTCCAGCCTTTGGGAGG - Intronic
964800003 3:160545953-160545975 ACTGATCAGCAAGTTTTGGGGGG + Intronic
965829241 3:172765167-172765189 ACTGATCTGCAGTCCTTGTTGGG + Intronic
966367227 3:179202812-179202834 AGTGAACAGCAGCCTTTGGATGG + Intronic
968084940 3:195870021-195870043 ACAGAACAGCAGCCTTAGGGTGG + Intronic
969393188 4:6904416-6904438 CCTGATCTGCGGCCTATGAGTGG + Intergenic
969488102 4:7483464-7483486 TCTGTCCTGGAGCCTTTGGGAGG + Intronic
969959174 4:10925864-10925886 TCTGAGCTGGAGGCTTTGGGAGG + Intergenic
970094504 4:12447392-12447414 AGTGATCTGCAGACTTTTCGAGG - Intergenic
972765530 4:42150557-42150579 ACTGACATGCAGGATTTGGGGGG + Intronic
975974790 4:80082288-80082310 TCTGGGCTGGAGCCTTTGGGAGG - Intronic
981834896 4:149043168-149043190 ACTGGTATGCAGCCTTTGACTGG + Intergenic
984687714 4:182690126-182690148 CCTGATCTGCAGGATTTTGGCGG - Intronic
985347371 4:189020237-189020259 ACAGAACTGCAGCCTCAGGGTGG + Intergenic
985878782 5:2621170-2621192 ATTGCTGTGCAGCCTTTGTGGGG + Intergenic
986735382 5:10663869-10663891 AATGTCCTGCAGCATTTGGGAGG - Intergenic
988085228 5:26467550-26467572 ACTTAACTGCAACCTTTGTGAGG + Intergenic
990010748 5:50994666-50994688 ACTGTTCTGCAGCCTATTGGTGG - Intergenic
990916269 5:60909136-60909158 ACTCATCTGCTGCCTTTTGGTGG - Intronic
1000020568 5:157315123-157315145 CATGAGCTGCAGCCTTGGGGAGG - Intronic
1001040105 5:168328513-168328535 ACTGACCTGCAATCTTAGGGTGG + Intronic
1002559427 5:180071630-180071652 GCTGACCTGCAGCCTGTGGCCGG - Exonic
1002687478 5:181024925-181024947 GCTGATCTGCTGGCTTGGGGTGG - Intergenic
1005681067 6:28208457-28208479 ACTGGTCTGAAGGCTCTGGGTGG - Intergenic
1006020327 6:31114133-31114155 CCTGATCTGCAGCCAATGGCAGG - Intergenic
1006556991 6:34875572-34875594 ACTGAGCTCCAGCCATTAGGAGG - Exonic
1008534712 6:52499050-52499072 ACTGGTCTTCAGCCTTTGCAAGG + Exonic
1008644653 6:53501347-53501369 AGTGATCTTCTGCCCTTGGGAGG - Intronic
1011702892 6:89971987-89972009 AATGAGCTGCAGCCTGAGGGAGG + Intronic
1011957808 6:93045031-93045053 AGTTATCTTCAGGCTTTGGGCGG + Intergenic
1013434540 6:110089113-110089135 ATTGAATTGCAGCCTTTGGAAGG - Intergenic
1013938443 6:115629599-115629621 ACTGATATGCAGTCTTTCAGAGG + Intergenic
1015225656 6:130853979-130854001 AGTGAGCTGCAGCCAGTGGGGGG + Intronic
1015560225 6:134506627-134506649 TCTGATCTATAGCTTTTGGGGGG - Intergenic
1018449003 6:163888278-163888300 ACTGATCTGCTAATTTTGGGGGG - Intergenic
1018733856 6:166672989-166673011 CCTGACCTGCAGGCTCTGGGTGG + Intronic
1018858980 6:167697577-167697599 TCTGAGCTGCAGCCTCAGGGCGG + Intergenic
1019285882 7:222656-222678 GCTGCTCTCCAGCCTTTGGTTGG - Intronic
1022503042 7:30894477-30894499 TCTGATCTCCAGGATTTGGGAGG - Intergenic
1022814503 7:33901968-33901990 ACTGAGCTGGAGCTGTTGGGAGG - Intergenic
1023115355 7:36856647-36856669 ACAGAACTCCAGCCTCTGGGAGG - Intronic
1026509144 7:71013468-71013490 ACTGCACTCCAGCCTGTGGGGGG + Intergenic
1027435519 7:78160113-78160135 ACTGGTCTGCAGGCTGTGGGAGG + Exonic
1028614467 7:92749655-92749677 ACTGCTCTGCAGCACTTGGTGGG + Intronic
1030153293 7:106427060-106427082 GCTGACCTGCAGCCTGTGCGAGG - Intergenic
1030795686 7:113784393-113784415 ACAGTTCTGCAGGGTTTGGGAGG + Intergenic
1031923294 7:127616484-127616506 TCTGAAGTGCAGCATTTGGGTGG - Intergenic
1032293564 7:130613365-130613387 ACTGGTCTGAAGCCCTGGGGTGG + Intronic
1032551045 7:132784738-132784760 AATGCTCTGGAGCCTTTGAGAGG + Intergenic
1033417013 7:141170960-141170982 ATTGATCTACAGCCTTTGAATGG + Intronic
1039291232 8:36096242-36096264 ATTGATCTGCAGCCCCTGGTGGG - Intergenic
1040276046 8:46014136-46014158 CCTGATATGCAGCCCTTGTGTGG - Intergenic
1043979173 8:86618279-86618301 ACTGATCTGTGGCCCTGGGGTGG + Intronic
1044190689 8:89313316-89313338 AATGATCTCCAGCCTGAGGGGGG + Intergenic
1045035765 8:98175519-98175541 ACTGGACTTGAGCCTTTGGGAGG + Intergenic
1046227100 8:111296411-111296433 ACTCATCTGCTACCTTTTGGTGG + Intergenic
1048445279 8:134488681-134488703 CCTGAACTGCAGCCTGTTGGTGG - Intronic
1049565526 8:143336015-143336037 ACTGTTCCGCAGCCCCTGGGAGG - Intronic
1049741774 8:144244511-144244533 CATGATCTGCAGGCCTTGGGGGG - Exonic
1051385549 9:16504556-16504578 ACTGATCTCCAGTATTTGGAGGG - Intronic
1051818386 9:21135741-21135763 ATTTATCTGCAGCCATTGGGTGG - Intergenic
1055934307 9:81590636-81590658 ACTGTGTTGCTGCCTTTGGGGGG - Intronic
1059581410 9:115552717-115552739 ACTGATCAGCATTCTTTGGAAGG - Intergenic
1061298517 9:129690428-129690450 CCAGAGCTGCTGCCTTTGGGAGG - Intronic
1191670005 X:63740192-63740214 ACAGATTTGCAGCATTTAGGTGG - Intronic
1201786567 Y:17788754-17788776 ATTTATCTGCGGCCTTTTGGGGG + Intergenic
1201814986 Y:18117234-18117256 ATTTATCTGCGGCCTTTTGGGGG - Intergenic