ID: 934776913

View in Genome Browser
Species Human (GRCh38)
Location 2:96945031-96945053
Sequence GTTCTCAGGAGGCTAATAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934776913_934776921 30 Left 934776913 2:96945031-96945053 CCACCTATTAGCCTCCTGAGAAC 0: 1
1: 0
2: 0
3: 10
4: 182
Right 934776921 2:96945084-96945106 GCCATCTAGCGAAGTGCTTGAGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934776913 Original CRISPR GTTCTCAGGAGGCTAATAGG TGG (reversed) Intronic
901297278 1:8170278-8170300 CTCCCCAGGAGGCTAATGGGAGG - Intergenic
901433304 1:9231459-9231481 GTACTCAGGAGGCTAAGGCGGGG + Intergenic
901883773 1:12208835-12208857 GTACTCAGGAGGCTGAGGGGAGG + Exonic
903891835 1:26574910-26574932 GTTCACAGGAGGCCAGTGGGCGG + Intronic
905035700 1:34917038-34917060 GGTCTGAGGAGGCCAATAGGTGG + Intronic
905297486 1:36963320-36963342 GGTCTCAGGAGGCTGAGCGGGGG - Intronic
906483508 1:46217044-46217066 TTTCTCAGGATGCTACTAGAGGG + Intronic
907083802 1:51649985-51650007 GCTCTCAGGAGGCTGAGAGGTGG - Intronic
907159010 1:52357905-52357927 GTGCCCAGGAGGCTGTTAGGAGG + Exonic
908194783 1:61738232-61738254 CTTCTCAGGAGGCTAACATGGGG + Intergenic
908710944 1:67013442-67013464 TTACTCAGGAGGCTAAGATGGGG + Intronic
910231979 1:84997083-84997105 GTTCTCGGGCGGCTGAAAGGCGG + Intronic
912573642 1:110643820-110643842 GTTCTTGGGAGGCTACCAGGAGG + Intergenic
914792313 1:150889032-150889054 ATGCTCAGGAGGCTAAAATGTGG - Intergenic
916955845 1:169833713-169833735 GCTCTTAGAGGGCTAATAGGTGG - Intronic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
923012960 1:230103645-230103667 GTTCTAAGGAGACAAGTAGGTGG + Intronic
923196980 1:231677866-231677888 CTACTCAGGAGGCTGACAGGAGG + Intronic
924123701 1:240828187-240828209 GTTGTCAGGAAGCTAACAGCAGG - Intronic
924483086 1:244453968-244453990 TTTCTCAGAAGGAGAATAGGAGG + Intergenic
1067050469 10:43014472-43014494 GCTATCAGGAGGCTGATATGGGG + Intergenic
1070203462 10:74231574-74231596 ATACTCAGGAGGCTGATGGGAGG - Intronic
1072497041 10:95972242-95972264 GTACTCAGGAAGAAAATAGGGGG - Intronic
1073134894 10:101215060-101215082 GTTCTCCGGAGGCTTAAAAGGGG + Intergenic
1073582164 10:104678618-104678640 GCCCTCAGGAGGCTAACAGTAGG - Intronic
1074703863 10:116114642-116114664 CTGCTCAGGAGGCTGAGAGGTGG - Intronic
1076348864 10:129800991-129801013 GTACTCAGGAGGCCTTTAGGCGG + Intergenic
1076392766 10:130115804-130115826 CTACTCAGGAGGCTGAGAGGTGG + Intergenic
1077699607 11:4429434-4429456 CTACTCAGGAGGCTGAGAGGTGG - Intergenic
1079645737 11:22861890-22861912 GATCTGAGGAGGCTCCTAGGAGG - Intergenic
1079668685 11:23138585-23138607 GTTCTCAAGAGGCTAATTTTGGG - Intergenic
1087170369 11:95043523-95043545 GTTCTGAGGAGGAAAAGAGGAGG - Intergenic
1087601573 11:100323066-100323088 GTTCTCAGGAAGCAGAGAGGTGG - Intronic
1087749382 11:101990209-101990231 GTGTTCATGAGGCAAATAGGAGG + Intronic
1088134965 11:106544091-106544113 CTACTCAGGAGGCTGATGGGAGG + Intergenic
1088476571 11:110246006-110246028 CTACTCAGGAGGCTGAGAGGTGG - Intronic
1089410118 11:118233881-118233903 TTACTCAGGAGGCTAAGATGGGG + Intronic
1096497482 12:52046870-52046892 CTACTCAGGAGGCTACTAGGAGG + Intronic
1097212343 12:57381924-57381946 CTACTCAGGAGGCTGATAGGAGG - Intronic
1100726238 12:97411987-97412009 GTTCTCAAGAAGCTCATAGTTGG + Intergenic
1101894356 12:108744970-108744992 CTACTCAGGAGGCTTGTAGGAGG - Intergenic
1102193092 12:111004102-111004124 GTACTCAGGAGGCTGAGATGGGG - Intergenic
1102285802 12:111655437-111655459 CTTCTCAGGCAGGTAATAGGTGG - Intronic
1102344475 12:112150660-112150682 CTACTCAGGAGGCTAAGAGTGGG - Intronic
1105564083 13:21526046-21526068 CTACTCAGGAGGCTGAGAGGTGG - Intronic
1105865544 13:24455726-24455748 CTTCTCAGGAGGCTAAGACAGGG - Intronic
1106530347 13:30585035-30585057 CTACTCAGGAGGCTGAGAGGTGG + Intronic
1106795867 13:33204985-33205007 GTTTTCAGGGGGCTCACAGGAGG - Intronic
1108561276 13:51646518-51646540 GTTGTCAGGAAGCTCACAGGGGG - Intronic
1111715424 13:91873790-91873812 CTACTCAGGAGGCTAACAGGAGG - Intronic
1118766843 14:68915643-68915665 GTTCTCAGGGGGCCAATGGCAGG - Intronic
1119374047 14:74174489-74174511 CTACTCAGGAGGCTATTGGGGGG + Intronic
1121955150 14:98206839-98206861 ATTCTCTGGAGGATAAAAGGAGG + Intergenic
1122107819 14:99471942-99471964 GTTGTCAGGAGGCTTAGAGAGGG + Intronic
1125846439 15:42859215-42859237 CTACTCAGGAGGCTGAGAGGTGG - Intronic
1126458686 15:48892449-48892471 GTTCTCTGGAGTCAAATAGAAGG + Intronic
1127353348 15:58174175-58174197 CTACTCAGGAGGCTGATAAGAGG + Intronic
1127867688 15:63044864-63044886 GTTGTCAGAAGGCTGACAGGTGG - Intronic
1130141721 15:81231481-81231503 CTACTCAGGAGGCTGAAAGGGGG - Intronic
1131405318 15:92159673-92159695 GTACTCAGGAGGCCGATGGGAGG - Intronic
1131686363 15:94772291-94772313 CTTCCCAGTTGGCTAATAGGGGG + Intergenic
1133926219 16:10194691-10194713 CTACTCAGGAGGCTAAGCGGCGG + Intergenic
1134135016 16:11672083-11672105 GTTCTCAGGGGGATCATAGGTGG - Intronic
1134621828 16:15695070-15695092 CTACTCAGGAGGCTGAGAGGTGG + Intronic
1135544534 16:23356890-23356912 GCTCTCTGGAGGCTGTTAGGAGG - Intronic
1136120347 16:28128895-28128917 ATTCTCAGGAGGGTAATGAGGGG - Intronic
1136930570 16:34414568-34414590 GCTCTCACTAGGCAAATAGGAGG + Intergenic
1136974004 16:34997240-34997262 GCTCTCACTAGGCAAATAGGAGG - Intergenic
1138362390 16:56442283-56442305 TTTCTCAGGAAGCTACTAGAGGG - Intronic
1138564881 16:57825788-57825810 CTACTCAGGAGGCTGAGAGGTGG - Intronic
1141309154 16:82896402-82896424 CTTCTCAGGAGGATGAGAGGTGG - Intronic
1141458805 16:84163913-84163935 CTACTCAGGAGGCTGAGAGGTGG - Intronic
1143469833 17:7165675-7165697 CTACTCAGGAGGCTAAGAAGGGG + Intergenic
1144281217 17:13728805-13728827 TTTCTAAAGAGGATAATAGGAGG + Intergenic
1148697357 17:49568561-49568583 GTTCTCAGCAGTCTAAAATGTGG + Intergenic
1148737769 17:49874436-49874458 GGGCTCAGGGGGCTGATAGGAGG + Intergenic
1150841122 17:68606642-68606664 CTACTCAGGAGGCTGACAGGTGG - Intergenic
1152147613 17:78577638-78577660 CTTCTCAGGAGGCTGAGGGGGGG - Intergenic
1153409456 18:4777505-4777527 GTTCTCAGGGGGCTCACAGCAGG + Intergenic
1155141612 18:23049394-23049416 GTACTCAGGAGGCTAAGGTGGGG + Intergenic
1160017289 18:75154526-75154548 GTGATCAGGAGGCCAATCGGTGG + Intergenic
1160230672 18:77046540-77046562 TTTGTCAGGAGGATAATTGGAGG - Intronic
1161324517 19:3657014-3657036 CATCTCAGGAGGGAAATAGGTGG - Intronic
1161506632 19:4647731-4647753 GTACTCGGGAGGCTGAGAGGGGG - Intronic
1161541724 19:4855810-4855832 CTTCTCAGGAGGCTGAGAGCTGG + Intronic
1165086417 19:33351167-33351189 CTACTCAGGAGGCTGAGAGGTGG + Intergenic
1165857628 19:38889490-38889512 CTTCACAGGAGGCAAATCGGAGG + Intronic
1166488337 19:43233871-43233893 CTACTCAGGAGGCTAAAGGGAGG + Intronic
1166983378 19:46645173-46645195 GTTCTCAGGTGGGTAAATGGAGG - Intergenic
1167352416 19:48983852-48983874 ATACTCTGGAGGCTAATGGGAGG - Intronic
1167916697 19:52745718-52745740 GCTCTCCCGAGGCAAATAGGAGG + Intergenic
927674544 2:25095583-25095605 CTACTCAGGAGGCTAAGATGGGG + Intronic
928327162 2:30328511-30328533 GTTCTCAGGATGCTCAGAGTTGG - Intergenic
929591097 2:43146828-43146850 CTACTCAGGAGGCTGACAGGAGG - Intergenic
931513748 2:63028511-63028533 GTACTCAGGAGGCTGAGGGGAGG - Intronic
932185896 2:69695029-69695051 CTACTCAGGAGGCTGAGAGGTGG + Intronic
933517791 2:83328191-83328213 TTAATCAGAAGGCTAATAGGAGG + Intergenic
934776913 2:96945031-96945053 GTTCTCAGGAGGCTAATAGGTGG - Intronic
934784299 2:96993626-96993648 ATTCTCAGGTGGCCAAAAGGAGG + Intronic
938880049 2:135576253-135576275 CTTCTCAGGAGGCTGAGAGATGG + Intronic
938919479 2:135981775-135981797 CTACTCAGGAGGCTGATGGGAGG - Intronic
940423809 2:153508864-153508886 GTTCTTAGGAGATTTATAGGGGG - Intergenic
940694052 2:156956782-156956804 CTTCTCAGGAGGCTAACAAAAGG - Intergenic
941151450 2:161919610-161919632 GTTCTCAGGAGGCCCAAAGTGGG - Intronic
943191652 2:184685569-184685591 GCTCTCAGGAGACTAAAAGTGGG + Intronic
946208248 2:218126421-218126443 GTTCTCAGGGGCCTCAGAGGAGG - Intronic
947088570 2:226484057-226484079 CTTCTCAGGAGGTGAATAGAAGG + Intergenic
947919640 2:233857955-233857977 TTTCTTAGCAGCCTAATAGGTGG - Intergenic
948287560 2:236798239-236798261 GTTATTAGGAGGCTAAGAAGAGG + Intergenic
1169340414 20:4792365-4792387 GTTCTCGGGATGCTTCTAGGTGG + Intronic
1173212609 20:41047888-41047910 GTTGTCTGGACGCTAATGGGTGG - Intronic
1173370822 20:42433380-42433402 CTTCTCAGAAGGTTGATAGGGGG - Intronic
1173933829 20:46844327-46844349 CTACTCAGGAGGCTAAGTGGGGG + Intergenic
1179617423 21:42590888-42590910 GTTCTCAGTAAGCGAGTAGGGGG - Intergenic
1180911214 22:19451986-19452008 TTTCTCAGGAAGCTCCTAGGAGG - Intronic
1181002671 22:19995160-19995182 GTGGACAGGAGACTAATAGGTGG + Intronic
1183425539 22:37737235-37737257 GTTCTCAGGAGGCTAGGAGATGG + Intronic
1183615741 22:38944254-38944276 CTACTCAGGAGGCTGAAAGGTGG - Intergenic
950080016 3:10214981-10215003 CTACTCAGGAGGCTGATGGGAGG + Intronic
950387119 3:12668927-12668949 GGTCTCAGAAGAGTAATAGGAGG + Intergenic
950990089 3:17425514-17425536 CTACTCAGGAGGCTGAGAGGTGG + Intronic
954461303 3:50628605-50628627 GTACTCAGGGGGCTCACAGGTGG + Intronic
956012774 3:64849300-64849322 GTACTCAGGAGGCTGAGATGGGG - Intergenic
958048412 3:88315320-88315342 GATCTGAGTTGGCTAATAGGTGG + Intergenic
965847191 3:172977499-172977521 GTTTTCAGGAGACTATTAAGAGG - Intronic
973960691 4:56107081-56107103 CTACTCAGTAGGCTAAAAGGGGG - Intergenic
976350542 4:84055383-84055405 CTTCTCAGTGGGCTAATATGGGG + Intergenic
976404966 4:84652981-84653003 CTACTCAGGAGGCTAAAAGGTGG - Intergenic
977501142 4:97839236-97839258 ATTCTCATGAGGCAAGTAGGTGG + Intronic
979979122 4:127232805-127232827 GTTCTCAGGAAGCTTATGGTAGG - Intergenic
982181505 4:152752090-152752112 GTTCTCAGGAGACTCAAAGTGGG - Intronic
985227759 4:187781032-187781054 GCTCTCAGGGCCCTAATAGGGGG - Intergenic
985544490 5:502307-502329 GTTCTCACGCTGCTAATAAGGGG - Intronic
987629805 5:20454905-20454927 GTCCTCAGCAGGCAAACAGGAGG - Intronic
988848918 5:35159251-35159273 GTTCTCTGGAGGCCAAAAGAAGG - Intronic
994246899 5:97488773-97488795 GCTCTCAGGAGACTCATAGTGGG + Intergenic
995680708 5:114716083-114716105 CTTCTCAGGAGGCTGAGATGAGG - Intergenic
995701783 5:114943661-114943683 CTACTCAGGAGGCTAATATGAGG + Intergenic
996412777 5:123176598-123176620 CTACTCAGGAGGCTGAGAGGTGG + Intronic
997576403 5:134980835-134980857 CTACTCAGGAGGCTGATATGTGG - Intronic
999955153 5:156692968-156692990 GCTCTGAGGAGGATAAAAGGAGG - Intronic
1001777294 5:174338173-174338195 CTTCTCCAGAGGCTAAAAGGCGG + Intergenic
1002019637 5:176354781-176354803 GTCCTCAGGAAGCTAATGGAGGG + Intronic
1002333160 5:178459325-178459347 TTACCCAGGTGGCTAATAGGTGG + Intronic
1002845866 6:943614-943636 CTTCTTAGGTGGGTAATAGGTGG + Intergenic
1003317451 6:5025254-5025276 GTCTTCAGGAGGCTGAAAGGTGG + Intergenic
1005730276 6:28690423-28690445 GTTCTCCCTAGGCAAATAGGAGG - Intergenic
1008004082 6:46391501-46391523 GTTCTCAGGACGCTGACATGGGG + Intronic
1008897841 6:56578261-56578283 CTTCTCAGGAGGCTGAGATGAGG + Intronic
1009954680 6:70439059-70439081 TTACTCAGGAGGCTGAGAGGTGG + Intronic
1011897026 6:92240964-92240986 GTTCTAAAAAGACTAATAGGAGG + Intergenic
1014816536 6:125942013-125942035 GGTCTCAGGAGGCTGAGAAGTGG - Intergenic
1016983286 6:149873339-149873361 ATTCTCAGGAGGCTAAAAATGGG - Intergenic
1017478471 6:154824583-154824605 GTTCTCAGGATGCAGATTGGTGG + Intronic
1017505817 6:155067751-155067773 GTACTTGGGAGGCTAAGAGGTGG - Intronic
1018043011 6:159941533-159941555 GTTCTCTGTGGGCTAAGAGGAGG + Intergenic
1019880700 7:3858304-3858326 CTACTCAGGAGGCTAAGAGCGGG + Intronic
1020393921 7:7691804-7691826 TTTCTCAGGAGGGAAAAAGGTGG + Intronic
1024169423 7:46768717-46768739 TTTCTTAGGAGGACAATAGGAGG + Intergenic
1028690791 7:93647206-93647228 CTACTCAGGAGGCTGAAAGGAGG + Intronic
1029793960 7:102874675-102874697 CTACTCAGGAGGCTGACAGGTGG - Intronic
1031095580 7:117415645-117415667 GTTTTCAGGCGTCTACTAGGGGG + Intronic
1032463777 7:132130627-132130649 GTTCTCAGGAGGCACAAAGATGG + Intronic
1032910855 7:136427913-136427935 GTTCTCAGGAGGCTAAGGCAGGG + Intergenic
1032952053 7:136925859-136925881 GCTCCCAGGAGGCAAATAGAAGG - Intronic
1035281954 7:157784257-157784279 GGTCTCAGGAGGCCAAGTGGGGG + Intronic
1035283099 7:157789456-157789478 GCTCTCAGGAGGCTCGTGGGAGG + Intronic
1036131996 8:6124137-6124159 GTTCTTAGGAAGCAAAGAGGAGG + Intergenic
1039942427 8:42102559-42102581 CTGCTCAGGAGGCTAAGACGGGG + Intergenic
1044538817 8:93387243-93387265 ATTGTCATGAGGCTATTAGGAGG + Intergenic
1045041024 8:98224865-98224887 CTACTCGGGAGGCTAAGAGGAGG - Intronic
1046147314 8:110177905-110177927 CTACTCAGGAGGCTAAGATGGGG - Intergenic
1049304029 8:141889319-141889341 ATTCCCAAGTGGCTAATAGGAGG + Intergenic
1050276391 9:4005416-4005438 ACTCACAGGGGGCTAATAGGAGG + Intronic
1053344408 9:37367630-37367652 GTTCACATGAGGGTAATAGAGGG + Intergenic
1053649488 9:40150464-40150486 GGGCTCAGGAGGATAATAGTCGG + Intergenic
1053756261 9:41313420-41313442 GGGCTCAGGAGGATAATAGTCGG - Intergenic
1054535093 9:66225709-66225731 GGGCTCAGGAGGATAATAGTCGG - Intergenic
1055143387 9:72902660-72902682 GCTCTCAGGAGAGTAATAAGTGG + Intronic
1055478110 9:76683572-76683594 GTTCTCAGGAAGCTTACATGTGG + Intronic
1055531719 9:77191404-77191426 CTACTCAGGAGGCTGAGAGGTGG - Intronic
1056066374 9:82939711-82939733 GTTCTCAGAGAGGTAATAGGAGG - Intergenic
1057047780 9:91899224-91899246 GAACTCATGAGGCAAATAGGTGG + Intronic
1061031861 9:128089743-128089765 CTACTCAGGAGGCTGAGAGGTGG - Intronic
1186598912 X:11015260-11015282 GATCTCAGGAAGCTAAGATGTGG + Intergenic
1187495779 X:19794289-19794311 CTACTCAGGAGGCTGAGAGGTGG + Intronic
1189829147 X:44952887-44952909 CTACTCAGGAGGCTGAGAGGTGG - Intronic
1192890609 X:75386584-75386606 CTACTCAGGAGGCTGAGAGGTGG - Intronic
1195227249 X:102809998-102810020 TATTTCAGGAGGCTGATAGGTGG - Intergenic
1196391011 X:115207424-115207446 CTACTCGGGAGGCTAAGAGGTGG + Intronic
1197025664 X:121746331-121746353 TTTCTCAGGAGGATAAGAAGAGG + Intergenic
1199011361 X:142762665-142762687 CTCCTCAGGAGGCTTAGAGGTGG - Intergenic
1199091515 X:143698580-143698602 GTTCACACGAGGCTAAGAGAAGG - Intergenic