ID: 934779439

View in Genome Browser
Species Human (GRCh38)
Location 2:96960433-96960455
Sequence CCCTTGCCTTGCCAGGATGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 242}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934779439_934779449 11 Left 934779439 2:96960433-96960455 CCAGCATCCTGGCAAGGCAAGGG 0: 1
1: 0
2: 0
3: 19
4: 242
Right 934779449 2:96960467-96960489 GGGCATCAGCAGATGCACCTCGG 0: 1
1: 0
2: 2
3: 50
4: 299
934779439_934779447 -9 Left 934779439 2:96960433-96960455 CCAGCATCCTGGCAAGGCAAGGG 0: 1
1: 0
2: 0
3: 19
4: 242
Right 934779447 2:96960447-96960469 AGGCAAGGGGCAGGAGGGCCGGG 0: 1
1: 1
2: 7
3: 120
4: 921
934779439_934779451 23 Left 934779439 2:96960433-96960455 CCAGCATCCTGGCAAGGCAAGGG 0: 1
1: 0
2: 0
3: 19
4: 242
Right 934779451 2:96960479-96960501 ATGCACCTCGGCCTGAGGCATGG 0: 1
1: 0
2: 1
3: 11
4: 131
934779439_934779446 -10 Left 934779439 2:96960433-96960455 CCAGCATCCTGGCAAGGCAAGGG 0: 1
1: 0
2: 0
3: 19
4: 242
Right 934779446 2:96960446-96960468 AAGGCAAGGGGCAGGAGGGCCGG 0: 1
1: 0
2: 10
3: 118
4: 1051
934779439_934779450 18 Left 934779439 2:96960433-96960455 CCAGCATCCTGGCAAGGCAAGGG 0: 1
1: 0
2: 0
3: 19
4: 242
Right 934779450 2:96960474-96960496 AGCAGATGCACCTCGGCCTGAGG 0: 1
1: 0
2: 0
3: 8
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934779439 Original CRISPR CCCTTGCCTTGCCAGGATGC TGG (reversed) Exonic
900558554 1:3292100-3292122 CACAGGCCTTGGCAGGATGCTGG + Intronic
901659302 1:10788730-10788752 TCCTTGCTTTGCCTGGAAGCTGG + Intronic
902891535 1:19447800-19447822 CGGTGGCCTTGCCAGAATGCTGG + Intronic
903337428 1:22634485-22634507 CCCCTTGCTTGCCATGATGCAGG - Intergenic
904065352 1:27745919-27745941 TCCATTCCTTACCAGGATGCAGG - Intronic
904100356 1:28021272-28021294 CCCTTGCCTTCCCAGCATGATGG + Intronic
904411019 1:30324994-30325016 CCATTGCCCTGCCAGGGTGTGGG - Intergenic
904540902 1:31232536-31232558 ACCTTGCCTTCCCAAAATGCTGG + Intronic
905540752 1:38758451-38758473 CCCTTGGGTTGCCAGAATCCTGG + Intergenic
905914729 1:41676748-41676770 CCCTGCCCTGGCCAGGATGGTGG - Intronic
907045339 1:51297013-51297035 CCCTTTCTTAGCCAGGAGGCAGG - Intronic
908779290 1:67674727-67674749 CCCTCTGCTTGCCAGGATGCTGG - Intergenic
910621602 1:89261365-89261387 CCCTTGGCTTGCCAGTTTGTAGG - Intronic
913997272 1:143661706-143661728 CCCGGGCGTTTCCAGGATGCTGG + Intergenic
914781012 1:150785071-150785093 CCCTTGGCTTCCCAAAATGCTGG - Intergenic
916202297 1:162283720-162283742 CCCTGGCCTTTCCAGTCTGCAGG + Intronic
916749858 1:167714222-167714244 CCCTTTCTTAGCCAGGATTCGGG + Intergenic
918218913 1:182417696-182417718 TCCTTGGCTTGCCAACATGCTGG + Intergenic
919578139 1:199337268-199337290 TACTTGACTTGCCAGAATGCAGG + Intergenic
919639922 1:200037391-200037413 CCCTAGCATGGCAAGGATGCAGG - Intronic
920722990 1:208405702-208405724 CCCTTGGCCTCCCAGGGTGCTGG - Intergenic
921252035 1:213307338-213307360 GCCGCGCCTGGCCAGGATGCAGG + Intergenic
921866724 1:220094299-220094321 CCCTTGCCATCCCGGGCTGCAGG - Exonic
921902388 1:220463951-220463973 CCCTTCACTTGTCTGGATGCAGG + Intergenic
924314746 1:242784284-242784306 CTGTTTCCTGGCCAGGATGCTGG + Intergenic
1064426148 10:15231450-15231472 CCCTTGCCTTCTCAAAATGCTGG + Intronic
1065333380 10:24627935-24627957 CCCTTTCCTTGCCAAGGTGAAGG - Intronic
1065348208 10:24769615-24769637 CCCTTGGTTGCCCAGGATGCTGG - Intergenic
1065646067 10:27835077-27835099 GCCCTGCCCTGCCAGGACGCAGG - Intronic
1067083696 10:43227370-43227392 TCCAGGCCTGGCCAGGATGCAGG - Intronic
1067270916 10:44790638-44790660 CCCTTCCCATGGCAGGATGGTGG + Intergenic
1067732202 10:48820482-48820504 CCCTTGCAGTGCCGGTATGCCGG - Intronic
1069640706 10:69953850-69953872 TCCTACCCTGGCCAGGATGCAGG - Intronic
1069850936 10:71404602-71404624 CCCTTGACTGGCCAGCATTCAGG - Intronic
1070543043 10:77430996-77431018 CCCTGGCCTCTCCAGGCTGCAGG + Intronic
1070572590 10:77651205-77651227 CCCTTGCCCTGCAAGGAGGCTGG - Intergenic
1070576872 10:77686077-77686099 CCCTTCCCTTCCCTGGATGATGG + Intergenic
1072686965 10:97543226-97543248 GCCATGCCTGGTCAGGATGCAGG - Intronic
1073025803 10:100486544-100486566 CCCCTGCCTTACTAGGGTGCAGG + Intergenic
1074185759 10:111098374-111098396 CCCTTGCCTTGCCAGCACCCTGG + Intergenic
1076129481 10:128002941-128002963 GCCTTGGCTTCCCAAGATGCTGG + Intronic
1077099577 11:816144-816166 CCCAGCCCTTGCCAGGATTCTGG + Intergenic
1077142868 11:1032090-1032112 GCCCTGCCTGGCCAGGATGGTGG - Intronic
1077618341 11:3695940-3695962 CCCTTGGCCTGCCAGAGTGCTGG - Intronic
1079873297 11:25827314-25827336 ACCTTGGCTTCCCAGAATGCTGG - Intergenic
1079881618 11:25934947-25934969 CCCTTTCCTTGGGAGGCTGCAGG - Intergenic
1080592583 11:33736493-33736515 CCCTTGCCCTCCCAGGCTCCCGG + Intergenic
1083195495 11:61083411-61083433 CCCTTGCCCTGCCCGGGAGCAGG + Intergenic
1083233211 11:61336234-61336256 CCCTGGCCCTGGCTGGATGCAGG + Intronic
1083582421 11:63833337-63833359 CCCTTGGCCTCCCAAGATGCTGG - Intergenic
1088472330 11:110199500-110199522 ACCTTCCACTGCCAGGATGCTGG - Intronic
1089169801 11:116504060-116504082 CCCTCGCCCTGCCTGGATGGAGG - Intergenic
1090162512 11:124510425-124510447 TCCTTGCCTTGCCGGTGTGCAGG - Intergenic
1090956190 11:131514839-131514861 GCCTTGGCTTCCCAAGATGCTGG + Intronic
1092132505 12:6122644-6122666 CCCTTCCCTTGCTAAGATTCTGG - Intronic
1094175339 12:27535646-27535668 GCCTTGGCTTCCCAAGATGCTGG + Intronic
1096057538 12:48666929-48666951 GCCTTGGCTTCCCAGAATGCTGG - Intronic
1096801032 12:54110604-54110626 CCCTGGCCTTACCTGGAAGCTGG - Intergenic
1099171161 12:79366443-79366465 CCCTGACCTTGCCAAGAGGCAGG + Intronic
1099850545 12:88090380-88090402 ACCTTGACTTCCCAGAATGCTGG - Intronic
1100842219 12:98624205-98624227 CATTTGCCTTGACAGGATGGAGG + Intronic
1101373467 12:104151281-104151303 ACCTTGCCTTCCCAAAATGCTGG + Intergenic
1103001243 12:117386806-117386828 CCCCTGTCCAGCCAGGATGCTGG + Intronic
1104221046 12:126785448-126785470 CCCTTGCCTTGTCCAGCTGCTGG - Intergenic
1104954956 12:132459825-132459847 CCCTGGCCTTGCCACCATGCCGG + Intergenic
1107893220 13:44932191-44932213 CCCTTGCCTTCCCAAAGTGCTGG + Intergenic
1109887263 13:68558378-68558400 CCCTTGCCTTGCTAGAATAGGGG - Intergenic
1113372259 13:109734238-109734260 CCCCTGCCTGGCCTGGATGTTGG - Intergenic
1113642407 13:111967215-111967237 CCATGGCCTTCCCAGGATGGTGG - Intergenic
1113877495 13:113603379-113603401 CACTTGCCTGGCCAGGATGGAGG - Intronic
1113931136 13:113969572-113969594 CCCGTGCCTTGCCATGGTGCTGG + Intergenic
1118607387 14:67514352-67514374 CCCTGCCCTTGCCAGGAACCGGG + Intronic
1121812342 14:96902200-96902222 CACAGGCATTGCCAGGATGCTGG - Intronic
1121973687 14:98382800-98382822 CCCTTGGAATGCCAGGAGGCAGG - Intergenic
1122149591 14:99717746-99717768 GCCTCGCCTTCCCAGGATGCAGG - Intronic
1122803817 14:104246801-104246823 TCCTAGCCTGGCCAGGATGAAGG + Intergenic
1122849878 14:104522420-104522442 ACCACGCCTTGCCAGGATGCTGG + Intronic
1123727872 15:23122972-23122994 ACCTTGGCTTGCCAATATGCTGG + Intergenic
1125521665 15:40351286-40351308 CCTTTGCCATGCCAGGCAGCAGG + Intronic
1125760840 15:42094486-42094508 CCCAGCCCTTGCCAAGATGCTGG + Exonic
1126607698 15:50495549-50495571 GCCTTGGCTTCCCAGAATGCTGG + Intronic
1128804856 15:70523074-70523096 CCACTGCCTCTCCAGGATGCAGG - Intergenic
1129579784 15:76795810-76795832 GCCTTGGCTTCCCAGGGTGCTGG - Intronic
1130163552 15:81427305-81427327 CCCTTGACTTGCAAGGATTATGG - Intergenic
1130169555 15:81497494-81497516 CCCTGGGCTTTCCAGGAGGCTGG + Intergenic
1131062644 15:89413350-89413372 CCCTTTCCTGGCCAGGGGGCTGG - Intergenic
1132852279 16:2030195-2030217 CCCAGGCCTTCCCAGCATGCAGG - Intronic
1132889228 16:2196030-2196052 CCCCTCCCTTCCCAGGCTGCGGG - Intronic
1133058478 16:3159143-3159165 CCCTCGCCTTGCCCGGCTACAGG + Intergenic
1133676964 16:8082420-8082442 TCCTTGCCTTGCAGGGAGGCAGG + Intergenic
1135918276 16:26625373-26625395 ACCTTGGCTTTCCAGGGTGCTGG + Intergenic
1136413449 16:30090428-30090450 CCCTGTCCTTGTCTGGATGCTGG + Intronic
1137277569 16:46946434-46946456 GCCTTGGCCTCCCAGGATGCTGG + Intergenic
1138528767 16:57623600-57623622 GCCTGGCCTAGCCAAGATGCGGG - Intronic
1139657527 16:68397930-68397952 CCCTGGCCTTGCCTGTCTGCAGG - Intronic
1142812214 17:2400662-2400684 CGCTTGCCATTCCAGGAAGCGGG + Exonic
1143096695 17:4482133-4482155 CCCTTGGCCTCCCAGAATGCTGG + Intronic
1143541861 17:7573766-7573788 CCCTCGCGTTGCCCGGATGTGGG - Intronic
1143688317 17:8537962-8537984 CCCCTGCCTTGCCAGACTGTGGG - Intronic
1146285513 17:31571785-31571807 GCCTGGCCTTTCCAGGCTGCAGG + Intronic
1146341886 17:32026676-32026698 GCCTTGGCTTTCCAGAATGCTGG + Intronic
1146350921 17:32092963-32092985 GCCTTGGCTTTCCAGAATGCTGG - Intergenic
1146449534 17:32961516-32961538 TCATTGCCTAGCCTGGATGCTGG - Intergenic
1147215473 17:38896568-38896590 CCCTTGCAAAGCCAGGAAGCAGG + Intronic
1147905656 17:43820991-43821013 GCCATCCCTTGCCAGGAGGCGGG - Exonic
1148783192 17:50133060-50133082 GCCTTTCCTTGCCGGGGTGCTGG - Intergenic
1149978350 17:61288821-61288843 TCCTGGCCTAGCCAGGATGGTGG + Intronic
1151342931 17:73483190-73483212 CCCAGGCCTTGCCTTGATGCAGG + Intronic
1152008969 17:77699084-77699106 CCCTGGCCTTGGCAGGATCCAGG + Intergenic
1152461871 17:80445865-80445887 CCTGTGCCTTGGCAGGATGAAGG + Intergenic
1154065721 18:11105143-11105165 CCCAGGCCTTGCCATGATGGAGG + Intronic
1154281680 18:13008956-13008978 GCCTTGGCCTGCCAGAATGCTGG + Intronic
1154948846 18:21188291-21188313 GCCTTGGCTTCCCAGAATGCTGG - Intergenic
1159796111 18:72846253-72846275 ACCTTGCCCTCCCAAGATGCTGG - Intronic
1160660473 19:295849-295871 CCATGGCCGTGCCAGGAAGCAGG - Intergenic
1160976302 19:1794403-1794425 CCCCTGCTCTGCCAGGATGTGGG - Intronic
1161739636 19:6012862-6012884 CCTTGGCTTTCCCAGGATGCTGG + Intronic
1163357284 19:16822061-16822083 ACCGTGCCGGGCCAGGATGCAGG + Intergenic
1163699799 19:18781467-18781489 CCCCTGCCTGGCCAGGACCCTGG - Exonic
1164611585 19:29636265-29636287 CCCCGGCCTTGCCAGGCAGCTGG + Intergenic
1166355848 19:42226809-42226831 CCCTTGCCTTCCCTGGATTTTGG + Exonic
1168638981 19:58018151-58018173 ACCATGCCTGGCCAGGATGAGGG - Intergenic
1202653080 1_KI270707v1_random:24257-24279 CCCTTTCCTTGCCAAATTGCAGG + Intergenic
927082848 2:19647677-19647699 CACTTCCCTAGCCAGGATGTGGG - Intergenic
927842001 2:26450671-26450693 ACCTTGCCTTACCTGGAGGCTGG - Exonic
928722638 2:34138181-34138203 CCCTTGCCTTCCTAGGAGGCAGG - Intergenic
928833353 2:35515528-35515550 CCCTAACCTTGAGAGGATGCCGG - Intergenic
929578197 2:43065937-43065959 ACCTTGGCTTGGCAGGATGAGGG + Intergenic
929925268 2:46202278-46202300 CCCCTGCCTTGCAGGGTTGCTGG + Intergenic
930741850 2:54839734-54839756 CCCTCTCCTTGCCAGGAACCTGG + Intronic
932373926 2:71217816-71217838 CCCTTGGCTTGCCAAAGTGCTGG - Intronic
932535650 2:72592197-72592219 CACTTTCCTTTCCTGGATGCTGG - Intronic
934538457 2:95156217-95156239 CCCATGCCTATCCTGGATGCTGG + Intronic
934779439 2:96960433-96960455 CCCTTGCCTTGCCAGGATGCTGG - Exonic
935309764 2:101772008-101772030 GCCTGGCCTTGCCAGGCTGAGGG - Intronic
937969046 2:127535816-127535838 CCCTTACCTTGTCAGGATGGGGG - Exonic
938131126 2:128716415-128716437 CCCCTGCATTGCCAGGACACTGG - Intergenic
943875114 2:193057783-193057805 GCCTTGCCTTCCCAAAATGCTGG - Intergenic
944743989 2:202637144-202637166 GCCTTGGCTTCCCAGAATGCTGG + Intronic
1169190314 20:3654780-3654802 GCCCTGCCTTGCCGGGCTGCTGG - Intergenic
1169206291 20:3742100-3742122 CCCTTGCCCTCCCAGGCTCCAGG - Intronic
1170961618 20:21030283-21030305 CCCTTCACTTGTCAGGATGCAGG - Intergenic
1171290952 20:23982528-23982550 CTCTTGCCTGACCAGGATGGTGG - Intergenic
1171795625 20:29564066-29564088 CCCTGGCCTTACCTGGAAGCTGG + Intergenic
1171852804 20:30320395-30320417 CCCTGGCCTTACCTGGAAGCTGG - Intergenic
1172006226 20:31820433-31820455 CCCTGGGCTTTCCAGGATCCTGG - Exonic
1174536969 20:51258687-51258709 GCCTTGCCTTGCCCTGAAGCAGG - Intergenic
1175154429 20:56960348-56960370 CCTCTGCCATCCCAGGATGCAGG + Intergenic
1175901961 20:62363504-62363526 CCCCTCCCCTGCCAGGATGCAGG - Intronic
1175970285 20:62682915-62682937 CCCTGGACTGGCGAGGATGCTGG - Intronic
1176117232 20:63438374-63438396 CCCTTGCCTTGTGTGGGTGCTGG - Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1179379927 21:40888914-40888936 CCCTTGCCCTGCAAGATTGCTGG - Intergenic
1180068064 21:45422654-45422676 CCCTTTCCTTGGCAGGGTGCTGG - Intronic
1182277084 22:29196359-29196381 CCCTTGCCATTCCAGGCTCCAGG - Intergenic
1182419687 22:30242903-30242925 CCCTGGCCATCCCAGGCTGCAGG + Exonic
1182548817 22:31090385-31090407 CCGTTGCCTTTCAAGGCTGCAGG - Intronic
1183485485 22:38085841-38085863 CCCCTGCCATGCCAGGCTCCTGG + Intronic
1183834969 22:40444816-40444838 GCCTTGGCCTGCCAGGGTGCTGG - Intronic
1183951298 22:41354547-41354569 CCCTTGCTCTTCCAGGCTGCTGG - Intronic
1184237712 22:43193513-43193535 GCCTTGGCTTGCCAGAGTGCTGG + Intergenic
950120981 3:10482495-10482517 CCCTTTCCTGGCCAGGCTGATGG + Intronic
950125833 3:10509299-10509321 CCCTTGCCTTGCCTGGCTCGGGG + Intronic
950981047 3:17304653-17304675 GCCTTGCCTTCCCAAAATGCTGG + Intronic
952838105 3:37621417-37621439 CCCTGGCCCTGCCTGGATGCCGG + Intronic
953870409 3:46621516-46621538 GCCTTGGCTTCCCAGGGTGCTGG - Intronic
957039439 3:75326091-75326113 CCCCAGCCTTGCCAGGTTTCTGG - Intergenic
958780050 3:98530215-98530237 GCCTTGGCTTCCCAGAATGCTGG - Intronic
961044162 3:123697369-123697391 CCCTAGCCTTGCCAGGTTTCTGG - Intronic
966767307 3:183474888-183474910 CCCTTCCCTTGGCAGAATGTTGG + Intergenic
968509109 4:987566-987588 CCCTGGCCCTGCCAGGAAGGCGG - Intronic
968663726 4:1809785-1809807 CCCTTGCCTGCCCAGGAAACGGG - Intergenic
968679329 4:1905806-1905828 TCCTTGGCTTGCCAGAATTCGGG + Intronic
969592680 4:8130856-8130878 TCCTTGCCTTGCCTGGCTGCTGG + Intronic
974434846 4:61843760-61843782 GCCTTGGCTTCCCAGCATGCTGG - Intronic
975208949 4:71676863-71676885 CTCTAGCCTTGCCACGAGGCTGG - Intergenic
975823341 4:78293813-78293835 CCTTTGCTTTGGCAGGAAGCTGG + Intronic
976183108 4:82417840-82417862 CCCTTGGCTTCCCAAGGTGCTGG + Intergenic
976489892 4:85658002-85658024 CCCTCGGCTTCCCAAGATGCTGG + Intronic
981336009 4:143569579-143569601 CCCTTGGCTTCCCAAGGTGCTGG + Intergenic
981850052 4:149219117-149219139 TCCTTGCCCTACCAGAATGCAGG + Intergenic
983760756 4:171403398-171403420 CCCTTCCCTTGCCTGGATCTAGG + Intergenic
983941322 4:173537294-173537316 CTCTTGACTTGCCAGTATGCTGG + Intergenic
985494949 5:199151-199173 CCCACTCCTTGCCAGGATGGTGG - Exonic
985706064 5:1401994-1402016 CCTTGGCCTGGCCAGGCTGCTGG + Intronic
986886677 5:12246313-12246335 CCGTTCCCTTGCCATTATGCTGG - Intergenic
988200863 5:28066768-28066790 TTCTTGCCCTGCCAGCATGCAGG + Intergenic
989385789 5:40853634-40853656 CCTTTGCCTTTTCAGAATGCAGG + Exonic
989780364 5:45257056-45257078 ACCCTGCCTTGTGAGGATGCTGG - Intergenic
993242872 5:85413828-85413850 CCCCTCCCTTCCAAGGATGCCGG + Intergenic
997190646 5:131931678-131931700 CCCCATGCTTGCCAGGATGCAGG + Intronic
997641258 5:135450281-135450303 CCCTTTCCTTTCCAAGAAGCAGG - Intronic
999124729 5:149238813-149238835 CCCCTGCTTAGCCAGGGTGCTGG + Intronic
999742197 5:154564804-154564826 ACCTTGGCTTCCCAGAATGCTGG - Intergenic
1000055909 5:157605971-157605993 ACCTTGGCTTTCCAGCATGCTGG + Intergenic
1001881297 5:175246533-175246555 GCATTGCCTTGCCAGCCTGCAGG - Intergenic
1002987271 6:2202653-2202675 CCCTTCCCTTGCCAGGACATAGG - Intronic
1004225665 6:13782184-13782206 CCCTTGCCTTCCCAAAGTGCTGG + Intergenic
1004996439 6:21198394-21198416 CCCCTGCTTTGCCAGGGTGTGGG - Intronic
1005151000 6:22750552-22750574 CCTTTGGATTGGCAGGATGCAGG + Intergenic
1012465051 6:99507798-99507820 CCACTGGCCTGCCAGGATGCTGG - Intronic
1012853158 6:104470729-104470751 GCCTTGCCTTCCCAAGGTGCTGG - Intergenic
1013030794 6:106330675-106330697 ACCTTGGCTTCCCAAGATGCTGG - Intergenic
1015444863 6:133291706-133291728 TCCTTGCATTGCTAGGAAGCTGG - Intronic
1015727907 6:136318524-136318546 ACCTTGGCTTCCCAGAATGCTGG - Intergenic
1016727572 6:147392756-147392778 CCCTTGACTTCCCAGAGTGCTGG + Intergenic
1017907353 6:158765880-158765902 CCATGGCCTTGGCAGGCTGCTGG - Exonic
1018626199 6:165781210-165781232 CCCTTGCCTTGCCAGAACCAAGG + Intronic
1019290597 7:248300-248322 CCCGTTTCTTGCCAGGATCCTGG + Exonic
1019539228 7:1544297-1544319 CCCTGGCCTGGCCCGGGTGCAGG - Exonic
1020513198 7:9085098-9085120 TCCTTGCCTTGCCACCATGGTGG + Intergenic
1022818791 7:33938521-33938543 CCCTTGCCTTTCCTAGATCCTGG - Intronic
1024461089 7:49660215-49660237 GCCCTGCCATGCCAGAATGCAGG - Intergenic
1032971082 7:137164495-137164517 CCGGTGCCTTGCCAAAATGCCGG - Intergenic
1033073590 7:138227520-138227542 GCCTTGGCCTCCCAGGATGCTGG - Intergenic
1033577703 7:142701955-142701977 CCCTTGGCTTCCCAGGTAGCTGG - Intergenic
1034053224 7:148005542-148005564 CCCCTTCCTTGACTGGATGCAGG - Intronic
1034280547 7:149850900-149850922 CCGGCGCCTGGCCAGGATGCAGG - Intronic
1034493579 7:151407403-151407425 CCCAGGCTTTGCCAGGCTGCCGG - Intronic
1035202712 7:157277384-157277406 CCCTCCCCTTGCCGGGCTGCTGG + Intergenic
1035363079 7:158326206-158326228 GCCTTGCCTTGTTTGGATGCAGG - Intronic
1035684647 8:1514297-1514319 CCCTTCGCTTCGCAGGATGCGGG - Intronic
1036926318 8:12909498-12909520 CCCCTGCCTTGCCAGGGTCAGGG + Intergenic
1037430490 8:18807854-18807876 CCCTTGGCTTCCCAGTGTGCAGG - Intronic
1037497233 8:19451592-19451614 CCCGTGCCTGGCCAGTACGCCGG + Intronic
1038319295 8:26513470-26513492 CACTCGCCTTGGCAGGCTGCAGG - Intronic
1039505186 8:38046948-38046970 CCCTTGCCCTGCTGGGAGGCAGG + Intronic
1041390031 8:57339654-57339676 CCCTTGCCAAGCCAGGGTGGGGG - Intergenic
1041721859 8:60983443-60983465 CCCTTGCCCTCCCTGGCTGCTGG - Intergenic
1042044522 8:64634318-64634340 ACCTTGCCTTCCCAAGGTGCTGG - Intronic
1045394254 8:101744840-101744862 CCCTTGGCTTTCCAGGCAGCAGG - Intronic
1046765995 8:118070816-118070838 CCCTTTTCTAGCCAGGATGGAGG - Intronic
1047318295 8:123754613-123754635 CCCCTGGCTTGCCAAGTTGCAGG - Intergenic
1047965771 8:130045687-130045709 CCCTTTCCTTGCAAGCAAGCAGG + Intergenic
1051363684 9:16304789-16304811 CCCCCACCTTTCCAGGATGCAGG - Intergenic
1053790600 9:41683675-41683697 CCCTGGCCTTACCTGGAAGCTGG - Intergenic
1054154560 9:61631126-61631148 CCCTGGCCTTACCTGGAAGCTGG + Intergenic
1054178945 9:61895374-61895396 CCCTGGCCTTACCTGGAAGCTGG - Intergenic
1054474337 9:65562202-65562224 CCCTGGCCTTACCTGGAAGCTGG + Intergenic
1054658592 9:67685457-67685479 CCCTGGCCTTACCTGGAAGCTGG + Intergenic
1056485423 9:87052075-87052097 CCCTGCCCTTGTCAGAATGCAGG - Intergenic
1056881283 9:90396074-90396096 CCCCAGCCTTGCCAGCAGGCAGG + Intergenic
1057196198 9:93116658-93116680 CACTTGCCCAGCCAGGCTGCGGG - Intergenic
1057746731 9:97758372-97758394 CCTTTTCCTTGCCAGGCTCCAGG + Intergenic
1061862910 9:133477023-133477045 GCCTGGCCTTACCGGGATGCAGG + Exonic
1062035817 9:134382106-134382128 CACATGCCCTGCCAGGATGTGGG + Intronic
1062321515 9:135992667-135992689 CCCTAGCCTGGGCAGGAGGCTGG - Intergenic
1062431500 9:136528637-136528659 CCCTTCCCTTCCCAGGGAGCCGG - Intronic
1062554883 9:137109482-137109504 CCATAGCCATGCCAGGCTGCTGG - Intergenic
1187675892 X:21716299-21716321 CCTTTGCCTTGCCAGTCTCCAGG + Intronic
1188199806 X:27284046-27284068 CCGTTGCCTGCCCAGGGTGCTGG - Intergenic
1188568928 X:31559214-31559236 CCCTTCCCTTGCTGGGTTGCTGG + Intronic
1189005365 X:36988330-36988352 CCATTGCCGTGCAAGCATGCTGG - Intergenic
1189043445 X:37567213-37567235 CCATTGCCATGCAAGTATGCTGG + Intronic
1189043661 X:37569612-37569634 CCATTGCCGTGCAAGCATGCTGG + Intronic
1189545386 X:42037347-42037369 ACCGTGCCTGGCCAGGATGAAGG + Intergenic
1194003111 X:88456561-88456583 CCCTTGCCTCTTCAAGATGCTGG - Intergenic
1196026871 X:111050570-111050592 CCTGTGCCTTGCCAAGATGAAGG + Intronic
1197967169 X:132077627-132077649 ACCTTGCCTTGCCACAGTGCTGG + Exonic
1199255954 X:145719193-145719215 CCATTGCCTTTCCTGGCTGCAGG + Intergenic
1200708725 Y:6465030-6465052 CTCCTGCATTGCCAAGATGCAGG + Intergenic
1201025387 Y:9699679-9699701 CTCCTGCATTGCCAAGATGCAGG - Intergenic