ID: 934780832

View in Genome Browser
Species Human (GRCh38)
Location 2:96968658-96968680
Sequence GGCCCCTGGGAGGAGGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 878
Summary {0: 1, 1: 0, 2: 5, 3: 105, 4: 767}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934780832_934780841 1 Left 934780832 2:96968658-96968680 CCATCACCCTCCTCCCAGGGGCC 0: 1
1: 0
2: 5
3: 105
4: 767
Right 934780841 2:96968682-96968704 CCTGGCTGTGAGCCCGTCCCAGG 0: 1
1: 0
2: 1
3: 64
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934780832 Original CRISPR GGCCCCTGGGAGGAGGGTGA TGG (reversed) Intronic
900044052 1:492633-492655 GGCCCCTGGGAGGCAAGGGAGGG + Intergenic
900065462 1:727539-727561 GGCCCCTGGGAGGCAAGGGAGGG + Intergenic
900078429 1:836460-836482 GGCCCCTGGGAGCTGGCTGGGGG - Intergenic
900087377 1:904946-904968 CGCCGCGGGGAGGCGGGTGAGGG + Intergenic
900100460 1:960125-960147 GGCTCCTCGGAGGAGGAAGAGGG + Intergenic
900100473 1:960161-960183 GGCTCCTTGGAGGAGGAGGAGGG + Intergenic
900169309 1:1258582-1258604 GGCCCGTGGGTGCAGGGTGGGGG - Intronic
900192752 1:1358424-1358446 GGGCCCTGGGAGGCGGGTGGGGG - Intronic
900313428 1:2045765-2045787 TGCCCCAGCGAGGAGGGTCAGGG - Intergenic
900392319 1:2439032-2439054 GGACCCTGGGAGCTGGGTCAGGG - Intronic
900428516 1:2591493-2591515 GGCCACTGGGGTGGGGGTGAGGG + Intronic
900665395 1:3811576-3811598 GAGCCGTGGGAGGAGGGTAATGG - Intergenic
900959456 1:5909860-5909882 TGGCCCTGGGAGGAGGCTGCTGG - Intronic
900990011 1:6094295-6094317 GGACGCTGGGAGGAGGGACAGGG - Intronic
901061790 1:6475134-6475156 GGGTCCTGGGAGGATGGTGGGGG + Exonic
901430538 1:9211390-9211412 GGTCCCTGGGAGGAAGGGGTGGG - Intergenic
901626885 1:10629733-10629755 GGCCCCCAGGAGGAAGGCGAGGG + Exonic
901643766 1:10705971-10705993 GGCCCCGGGGAAGAGAGTAAAGG - Intronic
901830000 1:11886494-11886516 GGGCCCTGAGAGGAGGGAGAGGG + Intergenic
901853913 1:12031978-12032000 GACCCTGGGGTGGAGGGTGAGGG + Exonic
901859349 1:12064111-12064133 GGCCACTGGCTGGAGGGTCAAGG + Intronic
902120445 1:14160431-14160453 TGCTGCAGGGAGGAGGGTGAGGG + Intergenic
902331470 1:15733030-15733052 GGGCCCTGGGAGGTGGGTGTGGG + Intronic
902331994 1:15735277-15735299 GGGCCCTGGGAGGTGGGTGTGGG + Intergenic
902528893 1:17077665-17077687 GGCCACTGAGTGGAGGGAGAAGG + Intronic
902706382 1:18208159-18208181 GGCCCCTGGGAGGAAGGGAAGGG + Intronic
902722478 1:18313164-18313186 GACCGCCGGGAGGAAGGTGAGGG + Intronic
903261086 1:22132201-22132223 GGCCTCTTGGAGAAGGGTGGGGG + Intronic
903274304 1:22210945-22210967 TGCCCCTGGGCAGAGGCTGAGGG + Intergenic
903337538 1:22635124-22635146 GGCTCCTGGGTGGAAGGGGATGG - Intergenic
903354032 1:22735615-22735637 GACCCCTGGGAAGTGGGAGAAGG - Intronic
903378707 1:22882508-22882530 GCCCTCAGGGAGGTGGGTGATGG - Intronic
903951810 1:26999956-26999978 GGCTCCTGTGAGGAGGGCGCTGG - Exonic
904041798 1:27589835-27589857 TCCCCCAGGGCGGAGGGTGAAGG - Intronic
904500590 1:30910528-30910550 GGCCCTTGGGAGGAGGACCAGGG + Intergenic
904577090 1:31511837-31511859 TGCCCCTGGGGGGTGGGAGAGGG + Intergenic
904610018 1:31720722-31720744 GGACCCAGAGAGGAGGCTGAGGG - Intergenic
905286193 1:36881996-36882018 GGCCTCAAGGAGGAGGGGGAGGG - Intronic
905480557 1:38259071-38259093 GGCCCATATGAGGAGGGAGAAGG + Intergenic
905528264 1:38655781-38655803 GGCTTCTCAGAGGAGGGTGAAGG + Intergenic
905792487 1:40797689-40797711 GGACCCTGGGGGGAAGGTAAAGG - Intronic
906325612 1:44843440-44843462 GGCCCCAGGGAGGAGGAGGGAGG + Intergenic
906746803 1:48227977-48227999 GGAGCCTGGGAGGAGGCTTAAGG - Intronic
907428831 1:54398723-54398745 GGGTCATGGGAGGAGGGTCACGG - Intronic
907517445 1:55001537-55001559 AGCCACGGGGAGGAGGCTGAGGG - Intronic
907915977 1:58870470-58870492 GGCCCCCGGGAGGAAGGGGGTGG + Intergenic
908048459 1:60199599-60199621 GGAGACTGTGAGGAGGGTGAGGG - Intergenic
908477738 1:64505783-64505805 GGCGACCGGGAGGAGGGTCAGGG - Intronic
908523324 1:64965863-64965885 GGCCCCAGGAAGGAGGCTGAGGG - Intronic
909980517 1:82094890-82094912 GGCCCCCGGGCTAAGGGTGAGGG + Intergenic
910953935 1:92680975-92680997 GGACCCTGGACGGAGGGTGGGGG + Intronic
911175547 1:94813966-94813988 CTTCCCTGGGAGGAGGTTGATGG + Intergenic
912205449 1:107503450-107503472 GGCCTGTTGGAGGAGGGTGTGGG - Intergenic
912551686 1:110489305-110489327 GGCCCCAGGGAAGGGGCTGAGGG + Intergenic
913209293 1:116570155-116570177 GGCCAATGTGTGGAGGGTGAAGG + Intronic
915056290 1:153134064-153134086 GGCCCCTGGGAGGAGTATTCAGG - Intergenic
915146893 1:153800714-153800736 GGCCTGTGGGAGGTGGGTGTGGG + Intergenic
915275519 1:154785422-154785444 GGCCCTTGGGAAGGAGGTGAAGG - Intronic
915285019 1:154847033-154847055 GGGCTCAGGGAGGGGGGTGAGGG - Intronic
915304630 1:154970396-154970418 GGCCCCAGGGATGAAGCTGATGG + Exonic
915458004 1:156053483-156053505 GGCCCCGGAGAGGAGGGCGGGGG - Intronic
915473649 1:156139891-156139913 GGGTGCTGGGAGGAGGGAGAGGG + Exonic
915538163 1:156550220-156550242 GGACCCTGGGAGGGGAGGGATGG - Intronic
915603334 1:156936056-156936078 AGCCTGTGGGAGGAGGATGAAGG + Exonic
915916137 1:159942044-159942066 GCCACCTGGGAGGATGTTGATGG - Intronic
916151488 1:161796452-161796474 GGACCCTGGGATGTGGGTGATGG + Intronic
916314012 1:163427519-163427541 CTCTCCTGGGAGGAGGGGGAGGG - Intergenic
916361692 1:163977152-163977174 GGGCCAAGGGAAGAGGGTGAAGG - Intergenic
916383725 1:164243563-164243585 GGAGAATGGGAGGAGGGTGAGGG + Intergenic
917272863 1:173297630-173297652 GGCCCATGAGAGGAGGCTGCAGG + Intergenic
917846168 1:179022303-179022325 GGAGCCTGGGGAGAGGGTGACGG - Intergenic
917930243 1:179817821-179817843 GCTCCCTGGGCCGAGGGTGAAGG - Intergenic
918047830 1:180952133-180952155 TGCCCATGGGAGGAGAGGGAGGG + Intergenic
918226101 1:182484662-182484684 GGCCCCTAGGGGCAGGGTGCAGG + Intronic
920179870 1:204126000-204126022 AGCCTCAGAGAGGAGGGTGAGGG + Exonic
920381334 1:205536268-205536290 AGCCCCTATAAGGAGGGTGATGG + Intergenic
920440767 1:205979111-205979133 GGCTCCTGGGAAGAGGCTGGAGG - Intronic
920912820 1:210233567-210233589 GCTGCCTGGGAGGAGGGTGCGGG - Intronic
921081146 1:211739142-211739164 GGTACCTGGGCGGGGGGTGAAGG + Intergenic
921963126 1:221057217-221057239 GGCGAGTGGGATGAGGGTGAAGG - Intergenic
922707068 1:227795441-227795463 CTCCCCTGGAAGGAGGGTGTTGG - Intergenic
922727189 1:227927953-227927975 GGACAAGGGGAGGAGGGTGAAGG + Intronic
922732578 1:227958771-227958793 TTCTCCTGGGAGGAGGGTGTGGG + Intergenic
923008751 1:230072022-230072044 GACACCTGGGAGGCTGGTGAAGG + Intronic
923056079 1:230426456-230426478 CGCCCCGCGGAGGAGGGTGGGGG - Intergenic
923388587 1:233490735-233490757 TGCTCCTGGGAAGAGGGTGTGGG - Intergenic
923660081 1:235950204-235950226 GGCTCTTGGCAGGAGTGTGAAGG + Intergenic
924502903 1:244653298-244653320 GGCCGCGGGGAGGAGGATGGGGG + Exonic
1063112492 10:3048806-3048828 GGCCCCAGGCAGGAGAGGGAGGG + Intergenic
1063357339 10:5412991-5413013 GGCCGCTGGGAGGTGAGTGGGGG + Intronic
1063383028 10:5597945-5597967 AGCCCCTGGGAGAAAGGGGAAGG + Intergenic
1064122655 10:12633273-12633295 GTCCCATGGGAGGAGGTTAATGG + Intronic
1064581304 10:16795862-16795884 AGCCCCTGGGAAGAGGGTGCCGG - Intronic
1065104837 10:22372479-22372501 AGCCACTGGGAGGTGGGTGAGGG + Intronic
1065971135 10:30806761-30806783 GGGCCCTGCCAGGAGGGTGCAGG + Intergenic
1066370342 10:34814626-34814648 AGCTCCCGGGCGGAGGGTGAGGG + Intronic
1067054388 10:43042587-43042609 GCCCACTGGGAGATGGGTGAGGG - Intergenic
1067102423 10:43342886-43342908 GGCCCTGGGGTGGAGGGTGGGGG - Intergenic
1067162887 10:43842318-43842340 GGCGCCAGGTAGGAGGGAGATGG + Intergenic
1067283529 10:44890990-44891012 CCCCCCTGGGAGGAGGATGTGGG + Intergenic
1068492018 10:57736584-57736606 GGCTCCTGGAAGGAGGGAGAAGG - Intergenic
1068657645 10:59591600-59591622 GGCCCCTGGGAGGGGTGTTCAGG - Intergenic
1069821113 10:71229342-71229364 AGACCCTGGGAGGATGGTGGGGG + Intronic
1069992758 10:72325230-72325252 TGCCCCTGGCCGGAAGGTGATGG - Intergenic
1070195326 10:74151356-74151378 GGACTTGGGGAGGAGGGTGACGG + Intronic
1070290769 10:75111835-75111857 GGCCCCGGGGAGACGGTTGAGGG + Intronic
1070789565 10:79181218-79181240 GGGGCCTGGGAGGAGGCTCAGGG + Intronic
1072071812 10:91925135-91925157 AGCCCATGGGAGTTGGGTGAAGG + Intronic
1073295205 10:102434669-102434691 GGCCCCTAGGAAGGGGGTGATGG + Intergenic
1074309839 10:112312691-112312713 GGCTCAGGGAAGGAGGGTGAGGG - Intergenic
1074960974 10:118445624-118445646 GGCCTCTGGGTGGAGAGTGATGG - Intergenic
1075223399 10:120603481-120603503 GGCCCTTCAGAGGAGGGGGATGG + Intergenic
1075424709 10:122332601-122332623 GGCTCCTGGTAGGAAGGTCAGGG + Intronic
1075617245 10:123899639-123899661 AGACCCTGGGAGGAAGGGGAAGG + Intronic
1075963391 10:126588212-126588234 GTCCCCAGGGGGAAGGGTGACGG + Intronic
1076335854 10:129706060-129706082 GGCCCCTGGCAAGAGGCAGAAGG - Intronic
1076364975 10:129915896-129915918 GGCCCCTGGGGAGACGGGGAGGG + Intronic
1076482724 10:130795488-130795510 GTGGCCTGGGAGGATGGTGAGGG - Intergenic
1076571631 10:131437209-131437231 GGGCAGTGGGTGGAGGGTGATGG - Intergenic
1076728167 10:132423030-132423052 AGGCCTGGGGAGGAGGGTGATGG - Intergenic
1076762441 10:132612116-132612138 GCCCCATCAGAGGAGGGTGAGGG + Intronic
1076764992 10:132628235-132628257 GGACCCTGGGAGGAGACTGATGG + Intronic
1076803627 10:132844342-132844364 GGCCCCAGGATGGACGGTGAGGG + Intronic
1076935579 10:133566180-133566202 GGGCCCTGGGAGGAGGGAGGAGG + Intronic
1077102322 11:827722-827744 GGACGCTGGGTGGAGAGTGAGGG + Intronic
1077137176 11:1006276-1006298 GGGCCGAGGGAGGAGGGTGCTGG + Intronic
1077269059 11:1666547-1666569 GGCCCCTGGGTGGGTGGTGGGGG - Intergenic
1077271489 11:1684168-1684190 GGCCCCTGGGTGGGTGGTGGGGG + Intergenic
1077881519 11:6354241-6354263 GGTCCCTGGGAGGCCTGTGAAGG - Intergenic
1077897617 11:6465483-6465505 CTCCCCTGTGGGGAGGGTGAGGG - Intronic
1078170900 11:8928546-8928568 AGCCTGTGGGAGGAGGGTGGAGG - Intronic
1078394977 11:10973033-10973055 GGCACCAGGAAGGAGGGTGAGGG + Intergenic
1078454779 11:11466537-11466559 GGACCCTGAGAGAGGGGTGAGGG + Intronic
1079023267 11:16925702-16925724 GGCCCCGGCGAGGAGGAGGAGGG - Intronic
1079243945 11:18739823-18739845 GGGCCCTGAGAGGAGGAGGAAGG - Intronic
1079329402 11:19521250-19521272 ACCCTCTGAGAGGAGGGTGAGGG + Intronic
1079992519 11:27261459-27261481 GGAGGATGGGAGGAGGGTGAAGG + Intergenic
1080147831 11:29009085-29009107 GGTGAGTGGGAGGAGGGTGAGGG - Intergenic
1080706156 11:34696163-34696185 GGAAGGTGGGAGGAGGGTGAGGG - Intergenic
1081604837 11:44520590-44520612 GACGCCTGGGTGGAGGGTGCTGG + Intergenic
1083168412 11:60906387-60906409 GGCGCCTCGGAGCACGGTGACGG - Exonic
1083264223 11:61538746-61538768 GGCCACTGGGAGAAGAGGGAGGG + Intronic
1083293646 11:61703538-61703560 GGTGCCTGGGAGGCTGGTGAGGG + Intronic
1083295430 11:61712758-61712780 GGCCACTGGGAAGAAGGGGAAGG + Intronic
1083659570 11:64245888-64245910 GGCCCCGGGGGGCAGGGTGGAGG - Intronic
1083681458 11:64353697-64353719 GGTCCCTGGCAGGAGTGAGAAGG - Exonic
1083720497 11:64601376-64601398 GGCCCCCGAGAGCAGGGTGGTGG + Intronic
1084203420 11:67577133-67577155 GGCCCCTGGTAGGTGTGGGAAGG + Intergenic
1084454121 11:69257647-69257669 GGCCCCTGTGAGGACTCTGAGGG + Intergenic
1085010970 11:73141759-73141781 GGCCCCTTGCGGGAGGGGGAAGG + Intronic
1085516892 11:77116719-77116741 GGCCCCTGGAGGCAGGCTGAGGG - Intronic
1085636848 11:78165603-78165625 GACCCCTGGGGGGAGGGCTAGGG + Intergenic
1087276654 11:96167553-96167575 GGTGCCTGGGAGAGGGGTGATGG - Intronic
1088157260 11:106822501-106822523 GGAGGCTGAGAGGAGGGTGAGGG - Intronic
1089162033 11:116445670-116445692 GGTCCCTGGGAAGAGGCTTAGGG - Intergenic
1089315809 11:117590549-117590571 GACCCCTGGAAGGACGGTGTGGG - Intronic
1090758074 11:129812547-129812569 GGAAAGTGGGAGGAGGGTGAGGG + Intergenic
1090847871 11:130545978-130546000 GCCCCCAGGGATGGGGGTGAGGG + Intergenic
1091228556 11:133972959-133972981 TGACCCTTGGAAGAGGGTGAAGG + Intergenic
1091273991 11:134337776-134337798 GGCCACTTGGAGGAGGGTGGAGG + Intronic
1091399969 12:175641-175663 AGGCCCTGGGAGGAGGGGGAAGG - Exonic
1091587966 12:1826968-1826990 GGCCCATGGGGGCAGGGAGAGGG + Intronic
1091760620 12:3084947-3084969 GGCCCCAGGGAGGCGGGAGGAGG - Intronic
1093084414 12:14851091-14851113 GTGCCCTGGGGGGAGGGTGAAGG + Intronic
1094536018 12:31323909-31323931 GGGCCCTGGGAGGAGCGGGGAGG - Intronic
1095949491 12:47773952-47773974 GCCCTCTGGAAGGAGGGAGATGG - Intronic
1096143840 12:49264726-49264748 GTCCACTGGGAGGAGGGAGCAGG - Intronic
1096183183 12:49562177-49562199 GGACCCTGGTAGTAAGGTGATGG + Intronic
1097302280 12:58031854-58031876 GGAGGGTGGGAGGAGGGTGAAGG - Intergenic
1099369401 12:81811639-81811661 AGCCCCTGGGGGGAGGGGCAGGG + Intergenic
1100339119 12:93661132-93661154 GTCCCCTGGGACAAAGGTGAAGG - Intergenic
1100678647 12:96894714-96894736 TTCCCATGGCAGGAGGGTGATGG - Intergenic
1101121194 12:101582004-101582026 GTCCCCTGTGAGGAGGGGCAGGG + Intronic
1101572553 12:105967185-105967207 TGCCTCTGGGATGAGGGTGCTGG - Intergenic
1101662267 12:106776030-106776052 CAACCCTGGGAGGAGAGTGATGG + Intronic
1102257637 12:111425359-111425381 GGCCCTTGGGAGGTGGGAGGGGG + Intronic
1102462070 12:113106063-113106085 GGAGGCTGGGAGGAGGGGGAGGG + Intronic
1102516087 12:113447825-113447847 GGCTGCAGGGAAGAGGGTGAGGG + Intergenic
1102926935 12:116833578-116833600 GGCTGCTGGGTGGCGGGTGAGGG + Intronic
1103395342 12:120602673-120602695 AGCCCCCGGGAGGAGACTGAAGG - Intergenic
1103742180 12:123098277-123098299 GGCTCATGGGAGGAGGAAGAAGG + Intronic
1104221215 12:126786732-126786754 GGCCCCAGGGTGGAGGGAAAGGG - Intergenic
1104727690 12:131087981-131088003 AGCCCGTGGGAGGAGAGAGAAGG - Intronic
1104766588 12:131333825-131333847 GGCCCCTGGAGGGTGGCTGAGGG + Intergenic
1104886278 12:132110821-132110843 GGCTCCTGGGAGCAGGATGCAGG + Intronic
1105458972 13:20566742-20566764 GGCCTCTGTGAGGAAGGGGAAGG - Intergenic
1106199492 13:27524446-27524468 TGGCCTTGGGAGGAAGGTGACGG + Intergenic
1106413088 13:29524584-29524606 GGCCCTGGGGAGAAGGGTGTGGG - Intronic
1109326731 13:60876922-60876944 TGCTCCTGGGAAGAGGGAGAGGG + Intergenic
1109589617 13:64460931-64460953 GGAGGGTGGGAGGAGGGTGAGGG - Intergenic
1111122991 13:83879098-83879120 GGCCCCGGGGCCGAGGGCGAGGG + Exonic
1112207271 13:97337166-97337188 CGCACATGGCAGGAGGGTGAGGG - Intronic
1112928805 13:104710732-104710754 GGCAGGTGGGAGGAGGGTGAGGG + Intergenic
1113030832 13:105991971-105991993 TGCCCCTGGAAGGAGGCTCATGG - Intergenic
1113625919 13:111846289-111846311 GGCCCCAGGAAGGACAGTGAGGG + Intergenic
1113788419 13:113015045-113015067 GGCCACTGGGAGGAGGTGGGTGG + Intronic
1113887165 13:113667055-113667077 GGCCCCTTGGAGGAAGGGGCCGG + Intergenic
1113937998 13:114005394-114005416 GACCTCTGGGTGGAGGTTGAGGG + Intronic
1116406588 14:44574004-44574026 GAAGGCTGGGAGGAGGGTGATGG + Intergenic
1118776584 14:68977882-68977904 GGCAGCCGGGAGGAGGGGGAGGG + Intronic
1119174839 14:72561539-72561561 GGGCACCAGGAGGAGGGTGAGGG - Intronic
1119189379 14:72670008-72670030 GGCCCCTGGGGCGATGGAGAAGG - Exonic
1119490454 14:75027849-75027871 GGAAGATGGGAGGAGGGTGATGG + Intronic
1119620928 14:76131345-76131367 GGCGCCTCGGAGGAGGGAGGGGG + Intergenic
1119626734 14:76183846-76183868 GGCACCAAGGAGGAGTGTGAAGG + Intronic
1119730989 14:76951044-76951066 GCCCCCTGGAAGGAGTCTGAAGG - Intergenic
1119808699 14:77499012-77499034 GGCCCCTCGGAGGAGGGTGGGGG - Intergenic
1120820266 14:88905796-88905818 GGAGGGTGGGAGGAGGGTGAAGG - Intergenic
1121013856 14:90536567-90536589 GACGCCAGGGATGAGGGTGAGGG - Exonic
1121050038 14:90814433-90814455 GCCTCCTGAGAGCAGGGTGAGGG + Intronic
1121111456 14:91315984-91316006 GGACGCTGGGGGGATGGTGATGG - Intronic
1121328227 14:93034143-93034165 GGCACCTGGGAGGAAGGTGTCGG - Intronic
1121942230 14:98082204-98082226 GGCACCTGGGTGGAGGGAAAGGG - Intergenic
1122098896 14:99391632-99391654 GATGCCCGGGAGGAGGGTGAGGG - Intergenic
1122159770 14:99774487-99774509 GTCCCAGAGGAGGAGGGTGAGGG - Intronic
1122209014 14:100162933-100162955 GGCTCCTGGGAGGTGTGGGAGGG - Intergenic
1122224675 14:100267473-100267495 GGGCCCTGTGAGGTGGGTCAAGG + Intronic
1122227715 14:100289446-100289468 GGCCCCTGGGAGGTGGAAGGAGG + Intergenic
1122647573 14:103205680-103205702 GGCCCATGGGAGGAAGGGGGTGG + Intergenic
1122707213 14:103629003-103629025 GGTCACAGGGAGGAGGGTGACGG - Intronic
1122882727 14:104697257-104697279 GGCTCCTGGGAGGCAAGTGAGGG + Intronic
1122920912 14:104879756-104879778 GGCCCCTGTGGGGGGCGTGAGGG + Intronic
1122931055 14:104933270-104933292 GGCCCTTGGCAAGAGGATGAAGG - Exonic
1123120176 14:105912775-105912797 GGCCTCTCAGAGGAGGGTGTGGG + Intergenic
1123180631 14:106467060-106467082 GACCCCAGGGAGGAGCCTGAGGG + Intergenic
1202940824 14_KI270725v1_random:143688-143710 GGCTCCTGGGTGGAAGGTGATGG + Intergenic
1123479264 15:20616043-20616065 GTCCCCAGGGAGCAGGGGGATGG + Intergenic
1123638749 15:22384342-22384364 GTCCCCAGGGAGCAGGGGGATGG - Intergenic
1124007106 15:25803140-25803162 GGCACCTGCGAGGAGGGAGACGG + Intronic
1124375878 15:29128364-29128386 GGCGGCTGGCAGGAGGGTGCAGG - Intronic
1124379386 15:29151897-29151919 GGGCCCTGGCAGGAGGGCTAAGG - Intronic
1124414913 15:29466681-29466703 GGGCCCGGGGAGGATGCTGATGG + Intronic
1124415039 15:29466986-29467008 GGGCCCGGGGAGGATGCTGATGG + Intronic
1124415069 15:29467054-29467076 GGCCCAGGGGAGGATGCTGATGG + Intronic
1125021743 15:34992980-34993002 GGCAGCTGGGAGCAGGGAGAGGG + Intergenic
1125186624 15:36938425-36938447 GGCCCCTGGGAGCAGGGGCTTGG - Intronic
1125828641 15:42695613-42695635 AGGCCCTGGGAGGTGGGTGAAGG + Intronic
1126156899 15:45574249-45574271 GGCTCCTGGGAGGAAGGGGGTGG - Intergenic
1126215321 15:46147065-46147087 GGCCCCTGGGAGGCTGCAGATGG - Intergenic
1126691977 15:51294725-51294747 GCCCCCCGGGAGGGAGGTGAGGG + Intronic
1128480885 15:68036781-68036803 GGCCCCTGGGAGGAGTGGTCAGG - Intergenic
1128529516 15:68434198-68434220 GGCACCTGTGAGGACGGTGAAGG - Intergenic
1128582341 15:68818767-68818789 GCCCCCTGCGCGGAGGGGGAAGG - Intronic
1128704980 15:69832167-69832189 GGCACTAGGGAGTAGGGTGAGGG + Intergenic
1128726543 15:69992207-69992229 GGCACCTGGGTGCAGGGTGTGGG + Intergenic
1128816186 15:70610281-70610303 GGCTCCTGGGAAGAAGGTCAGGG - Intergenic
1129082306 15:73052153-73052175 GGCTCCGGGGAGAAGGGGGAGGG + Intronic
1129184583 15:73898116-73898138 GAACCCAGGGAGGAGGCTGAAGG - Intergenic
1129281686 15:74490054-74490076 GGTGGCTGGGAGGAGGGTGGGGG - Intergenic
1129948506 15:79563100-79563122 GCCACCTGGGAGCAGGGAGAGGG + Intergenic
1130348044 15:83067045-83067067 GGCCCCAGAGAGGACGGTGAGGG + Exonic
1130353315 15:83109390-83109412 AGCCACTGGGAAGATGGTGATGG + Intronic
1130960058 15:88653268-88653290 GTGCCCTGGGAGCAGGATGAAGG + Intronic
1131157225 15:90082574-90082596 AGCCCCTGGGAGGAAGCTCAAGG - Intergenic
1131223884 15:90608014-90608036 GTCCCCTGGGAGGAGGGGTCAGG + Intronic
1131382766 15:91977612-91977634 GGACATTGGGAGGTGGGTGAGGG + Intronic
1131829895 15:96347507-96347529 GGCTCCGGCGAGGAGGGGGAGGG + Intergenic
1131838997 15:96416612-96416634 GGCGCCTGGGAGGAGCCAGAGGG + Intergenic
1131852778 15:96560690-96560712 GGCCCCTTGGACTAGGGTAATGG - Intergenic
1132258645 15:100401472-100401494 GCTCCCTGGGAGGAGGGATAGGG - Exonic
1132271089 15:100526394-100526416 TGCTCATGGGAGGAGGGTGCTGG - Intronic
1132317162 15:100898529-100898551 GCCCCCTGGGAGGAGTGGGGAGG + Intronic
1132346957 15:101114302-101114324 GGCCCCTGGGGGGAGAGTGGGGG - Intergenic
1132580908 16:684240-684262 GGCTCCGGGGCGGAGGGCGACGG - Exonic
1132668111 16:1091051-1091073 GGCCCCTGTGGGGAGGGAGTGGG + Intronic
1132698706 16:1213169-1213191 GGCCCCTTGGAGGATGGGGAGGG + Intronic
1132702293 16:1227045-1227067 GGTCACTGGGTGGAGGGGGAGGG - Intergenic
1132706032 16:1243823-1243845 GGTCACTGGGTGGAGGGGGAGGG + Intergenic
1132836009 16:1953919-1953941 GGACCCTTGGGGGAGGGGGAGGG - Intronic
1132939663 16:2500508-2500530 GGGCTCTGGGATGAGGGTGTGGG + Intronic
1133168422 16:3964983-3965005 GACCCCTGGGTGGAGGGTCGGGG + Exonic
1133209492 16:4255406-4255428 GGAGACTGGGAGGAGGGGGAAGG + Intergenic
1133982180 16:10641342-10641364 GGACCATGGGAGGAGAGTGTGGG - Intronic
1134079582 16:11315765-11315787 GGCCCCCAGCAGGAGGGGGAAGG + Intronic
1134252973 16:12587728-12587750 CTCCCCTGGGAGGAGGCTGGTGG - Intergenic
1134490755 16:14693935-14693957 GGTCCCTGGGAGGAGTGAGTGGG + Intronic
1134496136 16:14733053-14733075 GGTCCCTGGGAGGAGTGAGTGGG + Intronic
1134673493 16:16073175-16073197 GTACCCCTGGAGGAGGGTGATGG + Intronic
1135415225 16:22263819-22263841 GGCCCCAGGGAGGAGGGCCTTGG + Intronic
1135533003 16:23270628-23270650 GGAGGGTGGGAGGAGGGTGAGGG - Intergenic
1135589576 16:23695385-23695407 GTCCCCTGGAAAGTGGGTGATGG + Exonic
1136154668 16:28374777-28374799 GGTCCCTGGGAGGAGTGAGTGGG - Intergenic
1136208423 16:28740481-28740503 GGTCCCTGGGAGGAGTGAGTTGG + Intergenic
1136264512 16:29107157-29107179 GGTCCCTGGGAGGAGTGAGTGGG + Intergenic
1136297745 16:29313314-29313336 GGCCCCTGGCGGGAGGGTGTGGG + Intergenic
1136774822 16:32866329-32866351 GGGCCCTGGGTGGGGGCTGAGGG + Intergenic
1137382712 16:48013677-48013699 GGCCCCAGGGAGGTGGGGGGGGG + Intergenic
1137426339 16:48384716-48384738 CGCCGCGGGGAGGAGGGGGAGGG + Intronic
1138196009 16:55052817-55052839 AGGGCCTGGGAGGAGAGTGAGGG - Intergenic
1138196670 16:55057380-55057402 GGCCCGTGGGGGGAAGGTGTAGG + Intergenic
1138507559 16:57485916-57485938 GGCCCCGGGGAGGAGCAGGAAGG + Intronic
1138528014 16:57620060-57620082 TGGCCCTGGGAGGAGGTGGAAGG + Exonic
1138596694 16:58032952-58032974 GGCCCCGGGGAGGGGGCTGCCGG + Intronic
1138657407 16:58499357-58499379 AGCCCCTGGCAGCAGGGTGAGGG + Intronic
1138658476 16:58503965-58503987 GGGCCCTGTGGGGAGGGTGGGGG - Intronic
1139215543 16:65122258-65122280 GGCCCCTGGGGGGAGGGGCGCGG - Intronic
1139506763 16:67402048-67402070 GGCTGCTGGGAGGAGGAGGAAGG - Intronic
1139597619 16:67967629-67967651 GGCACCTGGGAGGAAGGAGGAGG + Intronic
1140326117 16:74005189-74005211 GGCCCCTGGGAGGAATGTGCAGG + Intergenic
1141165678 16:81659405-81659427 GGGTCCTGGGAGGATGATGATGG + Intronic
1141173253 16:81704256-81704278 GGGAGCAGGGAGGAGGGTGAAGG - Intronic
1141173260 16:81704277-81704299 GGGGGCAGGGAGGAGGGTGAGGG - Intronic
1141173269 16:81704297-81704319 GGGGACAGGGAGGAGGGTGAGGG - Intronic
1141173285 16:81704338-81704360 GGGGGCAGGGAGGAGGGTGAGGG - Intronic
1141173302 16:81704379-81704401 GGGAGCAGGGAGGAGGGTGAAGG - Intronic
1141173346 16:81704478-81704500 GGGGGCAGGGAGGAGGGTGAGGG - Intronic
1141173394 16:81704594-81704616 GGGGACAGGGAGGAGGGTGAGGG - Intronic
1141173431 16:81704697-81704719 GGGGGCAGGGAGGAGGGTGACGG - Intronic
1141263429 16:82474454-82474476 AGCCCCTGAGTGGAGGCTGACGG + Intergenic
1141482033 16:84313164-84313186 GGCCCGAGGGAGGGGGCTGAGGG + Intronic
1142059300 16:88019392-88019414 GGCCCCTGGCGGGAGGGTGTGGG + Intronic
1142111225 16:88332724-88332746 GGCTGCTGGGAACAGGGTGAGGG + Intergenic
1142174428 16:88638722-88638744 TGAGCCTGGGAGGAGGGTGTTGG + Intronic
1142177788 16:88652866-88652888 AGCCCCTGAGAGGAAGGTGGCGG + Intronic
1142193059 16:88726676-88726698 GGCCCCAGGGCGGTGGGTGCGGG + Intronic
1142265317 16:89061764-89061786 GGGCCCTGGCAGGAGGCTGCTGG - Intergenic
1142299273 16:89247271-89247293 GGCGCCAGGGAGGATGGAGAAGG + Intergenic
1203077244 16_KI270728v1_random:1128444-1128466 GGGCCCTGGGTGGGGGCTGAGGG + Intergenic
1142586727 17:979074-979096 GGGTCCTGGGATGAGGGTGCGGG + Intronic
1142625023 17:1186530-1186552 GGCCCCTGGGAAGTGTGTGGGGG - Intronic
1143213892 17:5209820-5209842 GGCATCTGGGAGGAGGCAGAAGG - Exonic
1143314561 17:6022457-6022479 GGTCCCTGTGTTGAGGGTGAGGG + Intronic
1143451277 17:7038338-7038360 GGCCACTAGGTGGAGGGAGAGGG - Exonic
1143502328 17:7346789-7346811 GGACCTAGGTAGGAGGGTGAGGG - Exonic
1143709857 17:8726783-8726805 GGGTCCTGGGAGGTGGGAGAAGG - Intergenic
1144282100 17:13736481-13736503 GGCCCAGGGTATGAGGGTGAAGG + Intergenic
1144646611 17:16979133-16979155 GGCATCTGGGAGGAGTGTGAAGG - Intergenic
1144730436 17:17522911-17522933 GGGCAGAGGGAGGAGGGTGAGGG - Intronic
1144754471 17:17670778-17670800 GGCTCCGGGGATGAGGGTGTGGG - Intergenic
1144757001 17:17685917-17685939 GGCGGCAGGGAGGAAGGTGAGGG - Intronic
1144846875 17:18224799-18224821 GGCCCCTGAGAGTAGGGGCAGGG + Intergenic
1144945889 17:18969284-18969306 GGCCCCAGGGAGGAGGGACACGG - Exonic
1145217102 17:21060866-21060888 GGCCCCAGGGTGGAAGGCGACGG - Intergenic
1145266367 17:21381407-21381429 GGTCCCAGGGAGGAGTGTGGTGG - Intronic
1145901630 17:28493940-28493962 GGCCACAGGGTGGAGGGTGGTGG - Intronic
1145970137 17:28951367-28951389 GGTGACTGGGGGGAGGGTGATGG + Exonic
1147119421 17:38327156-38327178 TGCCCTTGGGAGGCGGGTGGAGG - Exonic
1147119648 17:38328434-38328456 TGTCCCTGGGAGGTGGGTGCTGG - Exonic
1147119892 17:38329754-38329776 TGCCCCTGGGAGACGAGTGAAGG - Exonic
1147150500 17:38511062-38511084 GGCCCCTGGGTGCATGGTGTGGG + Exonic
1147150786 17:38512459-38512481 GGCCCAGGGAAGGAGGGCGATGG + Intergenic
1147155642 17:38543366-38543388 GAGCCCTGGGAAGAGGGAGAGGG + Intronic
1147156004 17:38544766-38544788 GGCCGGTGGGAGGAGGGGGCTGG + Intronic
1147244626 17:39111792-39111814 GGCCCCTGGGGTGAGGGCTAAGG + Intronic
1147402672 17:40190589-40190611 GGCTCCTGGTGGCAGGGTGAGGG - Intronic
1147816520 17:43214583-43214605 GGACCTTGGGAGGAGGTTGAGGG - Intronic
1147882522 17:43663137-43663159 GGGCCCTGGGGGGTGGGTGCAGG + Intergenic
1148862827 17:50613430-50613452 GGCCTCTTGGAGGAGGGTCCCGG + Intronic
1149304546 17:55335313-55335335 GGGGCCTGAGAGAAGGGTGAAGG - Intergenic
1149454825 17:56779451-56779473 GGTGCCTTGGAGGAGGGTGACGG + Intergenic
1149575341 17:57707939-57707961 GGCGCCTGGGAGGAGGGGAGGGG - Intergenic
1149651051 17:58276699-58276721 GGACCCTGGGAGGAGGATCCAGG - Intronic
1149655323 17:58306760-58306782 GGCTGGTGGGAGGTGGGTGAGGG + Intronic
1150223584 17:63510670-63510692 ATCCTCTGGGAAGAGGGTGAGGG - Intronic
1150433572 17:65137618-65137640 GGACCCTGGGAGGAGGGCGGGGG + Intronic
1151189349 17:72386962-72386984 GGCTCCTGAAAGGAGGGTGTCGG - Intergenic
1151313439 17:73308356-73308378 GGCCTGTGGGCGGAGGGAGAAGG - Intronic
1151322127 17:73358647-73358669 GGCCCATGAGAGGAGGGGGTTGG + Intronic
1151340390 17:73467233-73467255 GGTGTGTGGGAGGAGGGTGAGGG - Intronic
1151539270 17:74756962-74756984 GACTTCTGGGAGGAGGGTGAGGG + Intronic
1151990629 17:77571785-77571807 GGCATCGGGGAGGAGGGGGAAGG + Intergenic
1151995494 17:77606181-77606203 TGCCCCTGGGAGCATTGTGAGGG + Intergenic
1152342948 17:79735267-79735289 GTCCCCGGAGAGGAGGGAGATGG + Exonic
1152466863 17:80471411-80471433 GGCACCTGGGAGGAAGACGAAGG - Intronic
1152510067 17:80780763-80780785 GCCCCCCGGGGGGAGGGTGAGGG - Intronic
1152515381 17:80820552-80820574 GGCCCCACGGAGGAATGTGAGGG - Intronic
1152552022 17:81034821-81034843 GGGCCCTGGGAGCAGCCTGAGGG - Intergenic
1152626539 17:81390306-81390328 GGCGCTGGGGACGAGGGTGAGGG + Intergenic
1152641792 17:81452371-81452393 GGCCGCAGGGTGGCGGGTGAGGG + Intronic
1152701720 17:81822915-81822937 GGCCAGGGGCAGGAGGGTGAGGG + Intronic
1152794765 17:82301531-82301553 TCTCCCTGGGAGGAGGGAGAAGG + Intergenic
1152906816 17:82974874-82974896 GGCCCCTGGGAGGATGGAGTCGG - Intronic
1152906881 17:82975059-82975081 GGTCCCTGGGAGGATGGAGTCGG - Intronic
1152907144 17:82975856-82975878 GGCCCCTGGGAGGATGGAGTCGG - Intronic
1152907228 17:82976103-82976125 GGCCCCTGGGAGGATGGAGTCGG - Intronic
1152907370 17:82976534-82976556 GGCCCCTGGGAGGATGGAGTCGG - Intronic
1152984685 18:311097-311119 GGGCCCTGGGAAGACTGTGAAGG - Intergenic
1153003249 18:475226-475248 TGACACTGGGAGGAAGGTGAAGG - Intronic
1153307819 18:3648881-3648903 TGCCCCAGGGAGGAGGGTGAAGG + Intronic
1153624566 18:7011932-7011954 CTCCCCTGGGAGGTGGGTGGGGG - Intronic
1153929647 18:9866853-9866875 AGCCAGTGGGAGGAGGGTGGTGG + Intergenic
1153980070 18:10301245-10301267 GGACCCTGGGAAGTGGGTGGTGG + Intergenic
1155304919 18:24469648-24469670 GGTCCCTGAGAGGGGAGTGAAGG - Intronic
1155509418 18:26562074-26562096 TGCACCTGGGCGGAGGGCGAAGG - Intronic
1156239719 18:35241122-35241144 GGCCCCTAGGAAGAGGGAGGTGG + Intronic
1156618926 18:38825572-38825594 GGAAAGTGGGAGGAGGGTGAGGG - Intergenic
1157110290 18:44814131-44814153 GGCCAGTGGGAGTAGGGTGATGG + Intronic
1157110523 18:44816261-44816283 GACCCCTGAGAGGAGAGCGAAGG + Intronic
1157220099 18:45823283-45823305 GACACCTGAGATGAGGGTGAGGG + Intergenic
1157286025 18:46378009-46378031 GGCATTTGGGAAGAGGGTGAGGG + Intronic
1157311922 18:46559408-46559430 GGCCCCTGGGTGGGGGCTGTGGG - Intronic
1157496713 18:48161832-48161854 GGCGCCCGGGAGGAGGGCGATGG - Intronic
1157580524 18:48771548-48771570 GAACCCTGGGTGGGGGGTGAGGG - Intronic
1157591310 18:48837806-48837828 GGCATCTGGGAGCAGGGAGAGGG - Intronic
1157625202 18:49045166-49045188 GGGTCCTGGGAGGAGGAGGACGG + Intronic
1158735652 18:60075749-60075771 GGCCCCTGGGAGGAGTGCTCAGG - Intergenic
1158888193 18:61848827-61848849 GGCCACTGGCAGGAGACTGAGGG - Intronic
1158999145 18:62955327-62955349 GACACCTGGGAGCAGGCTGACGG + Intronic
1159590571 18:70331070-70331092 GCCACCTGTGAGGAGGGCGAGGG + Intergenic
1159812970 18:73038993-73039015 GGCCTCTGGGAGAAGAGGGATGG - Intergenic
1160068252 18:75598514-75598536 GAACCCTTGGTGGAGGGTGAAGG - Intergenic
1160145632 18:76361842-76361864 GGCCCCAGGGAGGAGTGCGATGG + Exonic
1160592675 18:79952660-79952682 GGCGCCTGGGTGAGGGGTGAGGG + Intergenic
1160766029 19:808468-808490 GGCCCCGGGGTGGAGGGGGCAGG + Intronic
1160788320 19:912087-912109 GGCCCCGGGGAGGTGGGGGGGGG + Intronic
1161156606 19:2735064-2735086 GGCCACTGTGATGAGGGGGAGGG + Intronic
1161157431 19:2739934-2739956 GGCCCCCGGGAGGTAGGTGCGGG - Exonic
1161299940 19:3537707-3537729 GGTGCCTGAGAAGAGGGTGAAGG + Intronic
1161461414 19:4400091-4400113 AGCCCCTGGGAGGAGGGGAGAGG - Intronic
1161474359 19:4475818-4475840 GTCCCCTGGGTGGAGGGGAACGG + Intronic
1161614559 19:5262804-5262826 GGTCGCGGGGAGGAGGGAGAGGG + Intronic
1162065632 19:8123740-8123762 GGCCCCTGGAAGGATGGGGAGGG - Intronic
1162150284 19:8640151-8640173 GGCCCCAGGAAGGTGGGTGAGGG - Intergenic
1162320550 19:9968724-9968746 GGCCCCTGGGAGAAGAGCAAGGG + Exonic
1162333427 19:10045071-10045093 GGCGGCTGGGAGGAGGGTCCTGG - Intergenic
1162480708 19:10925440-10925462 GGCCTCCCTGAGGAGGGTGAGGG - Intronic
1162500493 19:11050790-11050812 GGCCCCTGAGGGAAGGGTGCAGG + Intronic
1162757846 19:12870965-12870987 GCACCCTGGGCGGAGGGTGGGGG + Intronic
1162861180 19:13506518-13506540 GGGCCCGGGGAGGAGGGGGGAGG + Intronic
1162919147 19:13890032-13890054 GGGCCCCAGGAGGAGGGAGACGG - Exonic
1162933504 19:13968890-13968912 TGCCCCTGGGAGGGAGGTGGAGG + Exonic
1163018270 19:14469973-14469995 GGCCTCTGCAAGGAGGGTGAGGG + Exonic
1163034540 19:14563331-14563353 GGCCCCTGGGAGAGGGGTGCAGG - Intronic
1163622387 19:18368824-18368846 GGCCTCTGGGAGCTGCGTGACGG + Exonic
1163639100 19:18451410-18451432 GGTCCCTGGGCGGAGGGAGGCGG + Intronic
1163641442 19:18464696-18464718 GGCTTCAGGGAGGAGGGAGATGG - Intronic
1163722117 19:18903293-18903315 GGCCGCTGGGAGGCCGCTGAGGG - Exonic
1163831614 19:19549781-19549803 GACCCCTGGGCCGAGGGTGGAGG + Intergenic
1163916224 19:20242950-20242972 GGTCCATGGGAGGAGCTTGAAGG + Intergenic
1164307791 19:24020191-24020213 GGTCAATGGGAGGAGCGTGAAGG - Intergenic
1164399911 19:27895341-27895363 GGCCCTAGGGAGGAGGCTGAAGG - Intergenic
1164451645 19:28371223-28371245 GGATCATGGGAGGAGGATGAGGG - Intergenic
1164466794 19:28494017-28494039 TGCCCCTGGGAGGAAGCAGAGGG - Intergenic
1164686164 19:30168195-30168217 GGGTCCAGGGAGGAGGGTGCAGG - Intergenic
1164699899 19:30277898-30277920 GCCCTCTGGGAGGAGGGTGGTGG + Intronic
1164865520 19:31601286-31601308 AGAGCCTGGGAGGAAGGTGAGGG + Intergenic
1165112255 19:33509275-33509297 GGCCCCTGGGAAGAAGGGCACGG - Intronic
1165113309 19:33514377-33514399 TGACCCTGGCAGGAGGGTCAGGG - Intronic
1165144484 19:33722612-33722634 AGCCCCAGGGAAGAGGGGGAAGG - Intronic
1165154176 19:33777423-33777445 CGCCCCGGGGAGCAGGGTGTGGG + Intergenic
1165160610 19:33813556-33813578 GGCTGCTGGGAGGAGAGTGGTGG + Exonic
1165391542 19:35542031-35542053 GGCGCCTCTGAGGAGGTTGAGGG + Intronic
1165447790 19:35866241-35866263 GGCCCAAGGGGGGAGGGTGGTGG - Exonic
1165766545 19:38354953-38354975 GGCCCCTAGGCTGAGGGTGATGG + Intronic
1165810307 19:38607961-38607983 GACCCCAGGGAGGATGGGGAGGG - Intronic
1165900623 19:39167678-39167700 GCCCCGTGGGAGGGGGGTGGGGG - Intronic
1165907251 19:39201687-39201709 GGGTCCTCGGAGGAGGGTGTGGG - Exonic
1166117967 19:40667377-40667399 AGCCCCAGGGAGCAGGGTTAGGG + Exonic
1166352670 19:42207471-42207493 GGCCCCTGGGGGGAGTGGAAGGG - Intronic
1166365346 19:42275434-42275456 GCCTCCTGGGAGGAGGGCGATGG + Intronic
1166942916 19:46377656-46377678 TGCCCCTGGGATGGGAGTGAGGG - Intronic
1167234146 19:48303620-48303642 GGGCCCTGGGTGGAGGGAGGAGG - Intronic
1167517895 19:49933753-49933775 GGCCAGTGGGAGGAGGGGCAGGG + Exonic
1167679382 19:50909815-50909837 GGCTCCTGGGAGGAGAGTCAGGG + Intronic
1167792579 19:51690827-51690849 GGGCCTGAGGAGGAGGGTGAGGG - Intergenic
1168074436 19:53971883-53971905 AGCCCCTGGGAGGAGACTCAGGG + Intronic
1168307854 19:55445264-55445286 GGCCCCAAGCAGGAGGGCGATGG - Intergenic
1168315710 19:55483906-55483928 GGCCCCGGGGAGGCGGGGGATGG + Exonic
1168353808 19:55690267-55690289 GGCCACAGGGAGGAGGGTGCAGG + Intronic
1168553255 19:57317556-57317578 GGCCGCGGGGAGGAGGATGGGGG - Intergenic
1168608171 19:57776436-57776458 GGATCCTGGGAGGAGGAGGATGG + Intronic
925041674 2:735887-735909 GGCCCCTGGGAGGTGAATCAGGG + Intergenic
925294470 2:2768197-2768219 GGACGCTGGGAGGAGAGGGATGG - Intergenic
925587197 2:5475559-5475581 GGGGCCTGGGAAGAGGGAGAGGG + Intergenic
925619252 2:5774730-5774752 GGCTGCTAGCAGGAGGGTGAGGG - Intergenic
925959654 2:9003446-9003468 GGGGCCCGGGAGGAGGGTGGGGG - Intronic
928123298 2:28599298-28599320 GGCCTCTAGGAGCAGGGTGGGGG - Intronic
928323500 2:30302209-30302231 ATCTCCTGGGAGGAGGGTGTGGG + Intronic
929654412 2:43716204-43716226 GGCCCCTGGAAGAAGGGAGGAGG + Intronic
929668878 2:43853837-43853859 GGACACTAGGAGGAGGGTGTGGG - Intronic
931263498 2:60640133-60640155 GGAGCCTGGAAGGAGGGAGAGGG - Intergenic
932526496 2:72475481-72475503 GGCACCTGGGAGGAGTGTTCAGG + Intronic
932767769 2:74482160-74482182 GGCCCCTGGGACGTGGCTCAAGG + Exonic
933170361 2:79118227-79118249 GGAACATGGGAGGAGGGAGAGGG + Intergenic
933990592 2:87631394-87631416 GATCCCTGTGAGCAGGGTGAGGG + Intergenic
934780832 2:96968658-96968680 GGCCCCTGGGAGGAGGGTGATGG - Intronic
935098279 2:99968103-99968125 GGGCCTTGAGAGGAGGATGAGGG - Intronic
935658369 2:105443996-105444018 GGCCCCTGGCTGGAGGGAGCTGG + Intergenic
935982534 2:108641458-108641480 GGCCCCTGGGATGGGGTTGATGG + Intronic
936043531 2:109168445-109168467 GGCTCTTGGCAGGAGGGAGAGGG + Intronic
936083731 2:109452784-109452806 GGTCCCTGGGAGGCTGGTGCTGG + Intronic
936303254 2:111319430-111319452 GATCCCTGTGAGCAGGGTGAGGG - Intergenic
936707726 2:115095375-115095397 GGGCTTTGGGAGGAGTGTGAGGG + Intronic
937188844 2:120072769-120072791 GGCGCCTGTTGGGAGGGTGAGGG + Intronic
937270034 2:120643800-120643822 GACCCCAGGGATAAGGGTGAAGG - Intergenic
937428590 2:121819626-121819648 GGAGGCTGGGAGGGGGGTGAGGG - Intergenic
937998101 2:127710434-127710456 TGCCCCTGGGTGGAGGCTGTGGG - Intronic
938066384 2:128284065-128284087 GGGCCCTGGAAGTGGGGTGAGGG - Intronic
938096443 2:128467196-128467218 GGCTCCTGGGTGGATGGGGAAGG - Intergenic
938405794 2:131032448-131032470 AGCCCCAGGGAGGAGCCTGATGG + Intronic
939869552 2:147511633-147511655 ATCCCCTGGGAGGAGGAGGAAGG - Intergenic
941413754 2:165193151-165193173 GATCCCTTGGAGGAGAGTGATGG - Intronic
941919011 2:170830633-170830655 GGCACCTGTGAGGAGTGTGATGG - Intronic
942002859 2:171666625-171666647 GGTGCATGGGAGGTGGGTGAGGG + Intergenic
942215643 2:173716765-173716787 GGCCCAGGGGTGGAGGGTGGAGG + Intergenic
942426206 2:175863404-175863426 GGCCCCTGGGATGAGGGAGAGGG - Intergenic
942444531 2:176069203-176069225 GGGCCCTGGGAGGAAGGTGGTGG + Intergenic
944413189 2:199461971-199461993 GGCGCCTGGGTGGAGGGTGCAGG + Intronic
944703534 2:202266099-202266121 GGGCTCTGGGAGGAGGGAGAAGG + Intronic
945286720 2:208089821-208089843 GCCCACTTGGAGGAGAGTGAAGG + Intergenic
946197472 2:218043775-218043797 GGCTCCTGGGAGGAAGGTGGTGG - Intronic
946763473 2:223018826-223018848 GGCTCCAGAGAAGAGGGTGAAGG - Intergenic
947363705 2:229372452-229372474 GGCCTGTGGGAGGGGGGTGAGGG + Intronic
948320706 2:237066560-237066582 GGCAGGTGGCAGGAGGGTGAGGG - Intergenic
948352572 2:237353108-237353130 GGACTCGGGGTGGAGGGTGATGG + Intronic
948600810 2:239106580-239106602 GCCCTCTGGGAGGAGGGAGGAGG - Intronic
948665105 2:239529671-239529693 GGCACCTGGGAGGAGGGAAGAGG + Intergenic
948675615 2:239594887-239594909 GGCCCCAGGAAGGAGTGTGCTGG + Intergenic
948723860 2:239920019-239920041 GCACCCTGGGAGCAGGGTGAGGG - Intronic
948747686 2:240108069-240108091 TGCACCTGGGTGGAGGGTCAGGG + Intergenic
948846591 2:240685734-240685756 GGCACCTGGAAGGAGGGGGTTGG + Intergenic
948847270 2:240689000-240689022 GGCACCTGGAAGGAGGGGGTTGG - Intergenic
948886507 2:240887713-240887735 TGCTCCTGGGATGAGGGTGAGGG + Intronic
948942240 2:241202368-241202390 GCCCCCAGGGAGGCGGGTGTGGG + Intronic
949032850 2:241805211-241805233 GGTCCCTGGGTTGAGGGGGAGGG - Intergenic
949033350 2:241806421-241806443 GGTCCCTGGGCTGAGGGGGAGGG - Intergenic
949033782 2:241807492-241807514 GGTCCCTGGGTTGAGGGGGAGGG - Intergenic
949043469 2:241859655-241859677 GGCCCCGGGGAAGAAGGTCAAGG - Intergenic
1168761654 20:353854-353876 GGGCCTTGGGAAGAGGGTGTGGG - Exonic
1168793503 20:595954-595976 TGCCTCTGGGAGGAGAGTGAGGG + Intergenic
1168876462 20:1175492-1175514 GCCCTCTGGGAGGAGGAAGATGG + Intronic
1169329716 20:4706682-4706704 GGGCCCTGGGAAGAAGGTGAGGG - Intergenic
1170004150 20:11647062-11647084 GGCTCCTGGGTGGAAGGTGGGGG + Intergenic
1170142987 20:13143636-13143658 GGCCTCAGGGAGGAGGGTATGGG - Intronic
1171183037 20:23105003-23105025 GGTCCTGGGGAGGAGGGTGGAGG + Intergenic
1172830438 20:37829473-37829495 GGCCATTGGGATGATGGTGAGGG + Intronic
1172884077 20:38219764-38219786 GGCTCCTGGGAGGTGGGCGGAGG + Exonic
1173120234 20:40282381-40282403 GGCCCCTGGAAGGAGGCAGCTGG - Intergenic
1173729122 20:45316609-45316631 GGCCCCGGGGAGCAGGGGAAGGG + Intronic
1173970005 20:47145378-47145400 GGCCCCTGGGATCAGAGAGAAGG + Intronic
1174461281 20:50684686-50684708 GGCCGCTGGGACCAGGGTGGAGG + Intronic
1174652493 20:52139506-52139528 GGAGGGTGGGAGGAGGGTGAGGG + Intronic
1175190673 20:57210503-57210525 CTCCCCTGGGAGGCGGGTGGTGG - Intronic
1175482274 20:59320207-59320229 GACCTCTGAGAGGCGGGTGAGGG - Intronic
1175519111 20:59588402-59588424 GGCCCCAGGGACCAGGGGGACGG - Intronic
1175715819 20:61253406-61253428 CGCCCCTGGGCGGAGGCGGAGGG + Intronic
1175904988 20:62375301-62375323 GTCCCCTGCCAGGAGGGGGAGGG + Intergenic
1175921033 20:62450805-62450827 GGCTCCTGGGAGGAGGATGGAGG - Intergenic
1175941888 20:62541189-62541211 GGCCCTTGGGAGGAGGTGGGAGG + Intergenic
1175994480 20:62805929-62805951 GGCGCCTGGCAGGATGGTCAGGG - Intronic
1176235393 20:64051315-64051337 GGCAGCTGGCAGGAGGGTGCAGG + Intronic
1176548775 21:8212870-8212892 GGCCCGCGGGGGGAGGGGGAAGG - Intergenic
1176556670 21:8257079-8257101 GGCCCGCGGGGGGAGGGGGAAGG - Intergenic
1176567706 21:8395905-8395927 GGCCCGCGGGGGGAGGGGGAAGG - Intergenic
1176575609 21:8440121-8440143 GGCCCGCGGGGGGAGGGGGAAGG - Intergenic
1176582330 21:8543254-8543276 GGCTCCTGGGTGGAAGGTGATGG - Intergenic
1177892946 21:26828026-26828048 GGCAGCTGGGACTAGGGTGATGG + Intergenic
1178086076 21:29113401-29113423 GGCCTCTGGGAGAACAGTGAAGG - Intronic
1179191038 21:39121741-39121763 AGCCCCTGGGAGGAGGGCTCAGG - Intergenic
1179266202 21:39805715-39805737 GTCCCCTGGGAGGACTGTGCTGG + Intergenic
1179269624 21:39840632-39840654 GGCCCCAGGGGGAAGGGTGCAGG + Intergenic
1179469818 21:41603077-41603099 GGCTGCTGGGAGATGGGTGAAGG - Intergenic
1180092405 21:45539831-45539853 GGCCGCAGGGAAGAGGGGGAAGG + Intronic
1180163370 21:46007707-46007729 AGCTCCTGGGAGGAGTGGGAAGG - Intergenic
1180265165 22:10520302-10520324 GGCTCCTGGGTGGAAGGTGATGG - Intergenic
1180700618 22:17779638-17779660 GACCCCTGGGAGGGGAGAGAGGG + Intergenic
1180844393 22:18973347-18973369 GGGCCCTGGAAGGTGGGGGAAGG + Intergenic
1181057079 22:20265364-20265386 GGGCCCTGGAAGGTGGGGGAAGG - Intronic
1181235563 22:21445976-21445998 TGCCCGGGAGAGGAGGGTGAGGG + Exonic
1181323035 22:22023199-22023221 GGGCGATGGGTGGAGGGTGAGGG + Intergenic
1181436815 22:22915941-22915963 GGCCCCTGTGGGTGGGGTGAGGG - Intergenic
1181437656 22:22919867-22919889 GGCCCCTGTGGGTGGGGTGAGGG - Intergenic
1181438304 22:22922922-22922944 GGCCCCTGTGGGTGGGGTGAGGG - Intergenic
1181532009 22:23522204-23522226 GGCACCGGGGAGGAGGGGTAAGG - Intergenic
1181547094 22:23608244-23608266 GGCCTCTGGCAGCATGGTGAGGG - Intergenic
1181582970 22:23838039-23838061 GGGCCCTGGGATGAGGCTGTAGG - Intronic
1182453543 22:30435275-30435297 GGGCCCAGGGAGGAGAGGGAGGG - Intergenic
1183248835 22:36713905-36713927 GGACCCAGGGAAGAGGGTGCAGG - Intergenic
1183358645 22:37372243-37372265 GGCACCCGGGAGAAGGGAGAGGG - Exonic
1183455680 22:37921986-37922008 AGCCCCAGGGAGCAGGGTGCTGG - Exonic
1183498698 22:38165141-38165163 GCCACCTGGGTGGAGGGTGGAGG - Intronic
1183778827 22:39985452-39985474 GGCCCCTAGGTGGAGGTGGAGGG - Intergenic
1184194838 22:42920542-42920564 GGCCTTTGGGAGGAAGGAGAAGG - Intronic
1184225685 22:43127834-43127856 GGGCCCTGGGCGGTGGGTGGAGG + Intronic
1184273566 22:43398175-43398197 GGCCCCTGGAAGGAGGGCCAAGG + Intergenic
1184508660 22:44919036-44919058 GCCCCCCAGGAGGAGGGTGCAGG - Intronic
1184548839 22:45192945-45192967 GACCCCTGGGAGCCGGGTGATGG - Intronic
1184566107 22:45293115-45293137 GCCTCCTGGGAGAAGGGTGAGGG + Intronic
1184656522 22:45944577-45944599 GGCCCCTGAGATGAGGGTGGAGG + Intronic
1184663958 22:45977830-45977852 GGCCTGTGGAAGGAGGTTGAGGG + Intergenic
1184685274 22:46094015-46094037 GGGGCCTGGGAGGAGGCTGCAGG - Intronic
1184820382 22:46905537-46905559 GGCCCCGGGGAGGAGGGCACGGG + Intronic
1184959851 22:47921111-47921133 GGCCCCTTGGCTGTGGGTGATGG - Intergenic
1185006192 22:48278264-48278286 GGCCCCGAGGAGGCGGGAGATGG - Intergenic
1185085905 22:48740940-48740962 GGGCCCTGCGAGGAGGCAGATGG - Intronic
1185237900 22:49725311-49725333 GGGCCCAGGGAGGAGGGAGAGGG - Intergenic
1185279697 22:49964796-49964818 GGCCCCTGGGGTGGGGGTGGGGG - Intergenic
1185388386 22:50546877-50546899 GGCCCCTGGCAGGCGGGCGCGGG + Intergenic
1203253660 22_KI270733v1_random:129175-129197 GGCCCGCGGGGGGAGGGGGAAGG - Intergenic
1203261716 22_KI270733v1_random:174254-174276 GGCCCGCGGGGGGAGGGGGAAGG - Intergenic
950429327 3:12941794-12941816 GGGCCCTGGGGGTAGGCTGAGGG + Exonic
950440471 3:13007387-13007409 TGCCCCTGGGAGGAGGGCAGAGG + Intronic
950503272 3:13377628-13377650 GGCCCCTGTGCTGAGGGTGGTGG - Intronic
951030030 3:17871166-17871188 GGAGACTGGGAGGAGGGTGATGG - Intronic
951068431 3:18295665-18295687 GGTCCCTGGGAGGAGTGTTCAGG - Intronic
951074545 3:18373700-18373722 GGCCCCTAGGATGAGAGAGAGGG - Intronic
951868538 3:27334141-27334163 GGCCCTTGGGAGGAGGGTTTAGG - Intronic
951908046 3:27722582-27722604 TGAGCCTGGGAGGAGGGTGGGGG - Intronic
952396750 3:32927884-32927906 GGAGGTTGGGAGGAGGGTGAGGG - Intergenic
954305001 3:49720999-49721021 GGCTGCAGGGAGGAGAGTGAAGG - Exonic
954363506 3:50134576-50134598 GACCCCTGGTAGGAAGGTGGTGG + Intergenic
954456425 3:50602161-50602183 GCTTCCTGGGAGGAGGCTGAGGG + Intergenic
954876742 3:53807274-53807296 GGCCCCTGGGTGGTGCGTGGAGG + Intronic
954913250 3:54126731-54126753 GGCCCCTGGAGGGATGGTGCTGG + Intronic
955204582 3:56884288-56884310 GGGCTCTGGGAGGACTGTGAGGG + Intronic
956202278 3:66718993-66719015 GGCCGCTGGGGGGAGGGGGGGGG + Intergenic
956636458 3:71370052-71370074 GAGCACTGGGTGGAGGGTGAGGG + Intronic
957998806 3:87726532-87726554 GGCCTCTGGGTGATGGGTGATGG + Intergenic
960094581 3:113677014-113677036 AGCCCTAGGGAGGAGGGAGAAGG + Intronic
961495250 3:127286935-127286957 GGCTCCTGGGCGGTGGGGGAGGG + Intergenic
961781929 3:129325489-129325511 GGCCCCTGTGCTGAGGGTGGTGG - Intergenic
961815317 3:129547306-129547328 GGCCCGTGGGGGGTGGGTGAGGG - Intronic
961912158 3:130329126-130329148 GGCCACAGGTAGGAGGCTGAAGG + Intergenic
962195318 3:133357784-133357806 GGACGTTGGGAGGCGGGTGAGGG + Intronic
962810495 3:138955336-138955358 GGCCCCGAGGAGGAGGCTGCTGG - Intergenic
963041678 3:141074890-141074912 AGGCCCTGGCAGAAGGGTGAAGG + Intronic
963279019 3:143363063-143363085 GGTTCCTGGGAGAAGGGTGCAGG + Intronic
966869732 3:184282434-184282456 GGTTTCTGGGAGGAGGGTTAAGG + Intronic
966913424 3:184571673-184571695 GGACCCAGGGAGGAGGGAGATGG - Intronic
966919946 3:184604601-184604623 GGGCCCTGGGCGGAGAGTGTGGG + Intronic
967316266 3:188154276-188154298 CGCCCGCGGGTGGAGGGTGAGGG - Intronic
967984753 3:195086570-195086592 GGGCCCTGTGAGGAAGGTCAGGG + Intronic
968473637 4:792775-792797 GGTCCCGGGCAGGAGGGTCAGGG - Intronic
968594889 4:1477204-1477226 GGCCCCTCGGGAGAGGTTGAGGG - Intergenic
968817386 4:2829096-2829118 AGCAGCTGGGAGGAAGGTGAAGG - Intronic
968875050 4:3262274-3262296 GGAGCCTGGGAGGTGGGTGAGGG + Intronic
968875879 4:3267717-3267739 GGCCCCTGGAAGGAGGGGCTGGG - Intronic
968953060 4:3704419-3704441 GTCCCCAGGGAAGAGGTTGAGGG - Intergenic
968985200 4:3871263-3871285 GGTCCCTGGAAGGAGGTTTAGGG + Intergenic
969344458 4:6562572-6562594 GGGCCCAGTGAGGTGGGTGATGG - Intronic
969462044 4:7334100-7334122 GGCTCTTGAGAGGAGGGTGAGGG - Intronic
969694060 4:8725066-8725088 GGAACCTGCGAGGAGGGGGAGGG - Intergenic
970305598 4:14728725-14728747 GGAGGCTGGGAGGTGGGTGAGGG + Intergenic
971217415 4:24674099-24674121 GGCCCAGGGAAGGAGGGTGGAGG - Intergenic
971351811 4:25862612-25862634 GGCCCCGGGGACGCGGGTGGGGG - Intronic
971798472 4:31258723-31258745 GGAATATGGGAGGAGGGTGAGGG + Intergenic
973192401 4:47400709-47400731 GGAGGCTGGGAGGAGGGTAAGGG - Intronic
973853602 4:54987036-54987058 GGCCCCTGGGAGGAGTGTTAAGG - Intergenic
975529512 4:75386071-75386093 GGCCCCAGGGAGGCTGGAGAGGG - Intergenic
977377300 4:96222191-96222213 GTCTGCTGGTAGGAGGGTGATGG - Intergenic
978271592 4:106896555-106896577 GGAGGGTGGGAGGAGGGTGATGG + Intergenic
978990133 4:115070408-115070430 GGAGGGTGGGAGGAGGGTGATGG + Intronic
979547142 4:121951472-121951494 GGCCCGTGGGAGAAGGGCGGCGG + Exonic
980471872 4:133263244-133263266 AGCCCCTGAGGGGAGGGAGAGGG - Intergenic
980476744 4:133328031-133328053 GGAGGTTGGGAGGAGGGTGAGGG + Intergenic
980774254 4:137418922-137418944 GGAGATTGGGAGGAGGGTGACGG + Intergenic
982824240 4:159982248-159982270 GGAGGGTGGGAGGAGGGTGAAGG - Intergenic
983570999 4:169207969-169207991 GGGTCCTGGGATGAGGGGGATGG + Intronic
985140912 4:186840260-186840282 GTCTCCTGGCAGGAGGGTGGTGG - Intergenic
985508770 5:299998-300020 GGGCCCAGGGATGTGGGTGATGG + Intronic
985668521 5:1194375-1194397 GGGCGGTGGGAGGAGGGAGAGGG - Intergenic
985739354 5:1605918-1605940 GGGCCCAGGGATGTGGGTGATGG - Intergenic
985791487 5:1930815-1930837 GGCCTCCCGGGGGAGGGTGACGG + Intergenic
985884719 5:2668672-2668694 GGCGCCGGGGAGGAGGGGAAGGG + Intergenic
986086348 5:4454545-4454567 GGCCCCTGTTAGGAGGCGGATGG - Intergenic
987868136 5:23573433-23573455 GGAGGGTGGGAGGAGGGTGAGGG - Intergenic
988833808 5:35012083-35012105 GGAAGCTGGGAGGGGGGTGAGGG + Intronic
990271051 5:54139517-54139539 GGAGCCTGGGAGGTGGGTAAGGG + Intronic
990400218 5:55430026-55430048 GGCCCCTGGGAGGAGTGCTCAGG - Intronic
990907824 5:60822588-60822610 GGCACTTGGGAGGAAGGTCAAGG + Intronic
991001233 5:61785053-61785075 GGGCGGTAGGAGGAGGGTGAGGG - Intergenic
991743811 5:69710631-69710653 GGGGGCGGGGAGGAGGGTGAGGG + Intergenic
991753902 5:69844611-69844633 GGGGGCGGGGAGGAGGGTGAGGG - Intergenic
991795383 5:70290363-70290385 GGGGGCGGGGAGGAGGGTGAGGG + Intergenic
991803527 5:70401366-70401388 GGGGGCGGGGAGGAGGGTGAGGG - Intergenic
991823178 5:70585899-70585921 GGGGGCGGGGAGGAGGGTGAGGG + Intergenic
991833214 5:70719724-70719746 GGGGGCGGGGAGGAGGGTGAGGG - Intergenic
991887750 5:71289882-71289904 GGGGGCGGGGAGGAGGGTGAGGG + Intergenic
993213873 5:84993879-84993901 GGAGGCTGGGAGGAGGATGAGGG - Intergenic
993380952 5:87207202-87207224 GGACCTTGGGAGGGAGGTGAGGG - Intergenic
993864400 5:93175063-93175085 CACCCCAGAGAGGAGGGTGAAGG - Intergenic
996803380 5:127427995-127428017 GGCCCCTGCTGTGAGGGTGAAGG + Intronic
997466357 5:134090587-134090609 GGCCCAAGGGTGGAGGCTGAGGG - Intergenic
997576848 5:134985441-134985463 GGAGGTTGGGAGGAGGGTGAGGG + Intronic
997735829 5:136212146-136212168 CAACCCTGTGAGGAGGGTGATGG - Intergenic
997999245 5:138610957-138610979 GAGCCCTGGGAGGAGGGGGTTGG + Intronic
998384267 5:141747412-141747434 GGCTCAGGGGAGGAGGGGGAGGG + Intergenic
998402221 5:141853831-141853853 GGCCCCTGGGGGCTGGGAGATGG + Exonic
998600684 5:143581858-143581880 GGAGACTGGGAGGAGAGTGAGGG + Intergenic
998720450 5:144940698-144940720 GGAGTCTGTGAGGAGGGTGAGGG + Intergenic
998761401 5:145436073-145436095 GGAGGTTGGGAGGAGGGTGAGGG - Intergenic
999094669 5:148967196-148967218 GGACCCAGGTAGGAGGGTTAAGG + Intronic
999194245 5:149771306-149771328 GGCCCCTGGAAGCAGGCTCAGGG + Intronic
999340384 5:150765011-150765033 AGCCCCTGGGGTGAGGGTGGGGG + Intergenic
999379576 5:151110720-151110742 GGCCCTGGGGTGCAGGGTGAGGG + Intronic
1000182560 5:158825982-158826004 GGCCCATGGTAGGAGGGAAAAGG + Intronic
1001045130 5:168365624-168365646 TGCCCCTGAGAGGAGGGTAAGGG + Intronic
1001603457 5:172944009-172944031 GACCCCTGGGAGGAAGTTGCTGG + Intronic
1001810973 5:174627930-174627952 GTCCCCTGGGATCAGTGTGAAGG - Intergenic
1001894110 5:175363893-175363915 GGCCCCTGAGAGCATGGAGAAGG + Intergenic
1002043205 5:176528947-176528969 GGGCCCAGGGAGGATGGGGAGGG - Exonic
1002135305 5:177104039-177104061 GGCCCATGGGAGGGGACTGAAGG - Intergenic
1002313434 5:178328331-178328353 GGCCCCTTGGATGAGGATCAGGG - Intronic
1002443296 5:179275240-179275262 GGCACCTGGGAGAGGGGTAATGG + Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1002613765 5:180437618-180437640 GGCCCCTGGGAGCCAGGTCAAGG - Intergenic
1002729791 5:181326296-181326318 GGCCCCTGGGAGGCAAGGGAGGG - Intergenic
1003460040 6:6320708-6320730 GGGACAGGGGAGGAGGGTGAGGG - Exonic
1003540544 6:7014627-7014649 AGCCACTGGGCTGAGGGTGAGGG - Intergenic
1006030387 6:31173144-31173166 GGCCTCTCAGAGGAGGGGGAGGG + Intronic
1006147960 6:31970531-31970553 GGACTTGGGGAGGAGGGTGAAGG - Intronic
1006213253 6:32415354-32415376 GGGTCCTGGGAGGAGTGTGATGG - Intergenic
1006364923 6:33609747-33609769 GGCCCTTGGGAGGCTGGGGAGGG + Intergenic
1006370804 6:33642667-33642689 GGCCTGGGGGAGGAGGGAGAGGG - Intronic
1006388715 6:33746479-33746501 TTCCCCTGGGAGAAGGGAGAGGG + Intronic
1006603586 6:35241659-35241681 GGTACATGGGAGGAGGGTGCTGG + Exonic
1006645345 6:35511616-35511638 GGCCCCAGGGACGCGGGTGAGGG - Intronic
1006840751 6:37026643-37026665 CGTCCCTGGGAGGTGGGAGAAGG + Intronic
1006864549 6:37198724-37198746 GGAGGATGGGAGGAGGGTGAAGG + Intergenic
1007376820 6:41462702-41462724 AGCCCCTGGAAGGAAAGTGAGGG + Intergenic
1007680233 6:43628852-43628874 GACCCCAGGGAGGAGGGGCACGG - Intronic
1007951171 6:45873685-45873707 GCCCCCTGTGAGGAGGGAGGAGG - Intergenic
1008052856 6:46917667-46917689 GGCCTGTGGGGGGCGGGTGAGGG - Intronic
1008251761 6:49248479-49248501 GGAGGCTGGGAGGAGTGTGAGGG + Intergenic
1008663835 6:53696798-53696820 GGCCCTGAGCAGGAGGGTGAAGG - Intergenic
1010333076 6:74646946-74646968 GGCCCCTGGGTGAAGTGTGTGGG - Intergenic
1010817705 6:80378218-80378240 GGAGCATGGGAGAAGGGTGAGGG - Intergenic
1010882149 6:81190743-81190765 GGATGATGGGAGGAGGGTGAGGG + Intergenic
1011117119 6:83905944-83905966 GGCCCCTGGGAGGAGTGTTCAGG + Intronic
1011470200 6:87701356-87701378 GGCCCCTGGGGTGGGGGTGCCGG - Intronic
1011649838 6:89495345-89495367 GACCTCTGGGAGGAGGGTAGAGG + Intronic
1011715719 6:90103314-90103336 GGTGCCTGGGAGGAGGGACAAGG - Intronic
1012144296 6:95662134-95662156 GGAGGATGGGAGGAGGGTGAAGG + Intergenic
1013272829 6:108559490-108559512 GGCCCGGGAGAGGAGGGAGAAGG - Intergenic
1016243309 6:141956387-141956409 TGCCACTGGGGGTAGGGTGAAGG - Intergenic
1018903935 6:168064416-168064438 TCCCCCTGGGAGGAGGGCCATGG - Intronic
1018977338 6:168575445-168575467 AGCCCCTGTGAGCAGGGTGTGGG + Intronic
1019172347 6:170139769-170139791 GGCTTCTGGGAGGACGGTCAGGG - Intergenic
1019214792 6:170436128-170436150 GGCCCTTGGGAGGTGAGTGCTGG - Intergenic
1019274201 7:167284-167306 GGCCCCTGGGTGGAGGTTCCTGG + Intergenic
1019278208 7:187076-187098 GGCCCCTGGGAGGAGGTGGGAGG + Intergenic
1019282079 7:205675-205697 GGCCCCAGGCAGGAGGGAGATGG - Intronic
1019287566 7:231348-231370 GCCCCATGGGAGGAGGGTCCCGG + Intronic
1019287600 7:231441-231463 GCCCCGTGGGAGGAGGGTCCCGG + Intronic
1019287623 7:231503-231525 GCCCCGTGGGAGGAGGGTCCTGG + Intronic
1019356857 7:584749-584771 GCCCCCCGGGAGGAGGGAGGTGG - Intronic
1019415639 7:925484-925506 GGCCCCTGGAAGGCGGGTGGGGG - Intronic
1019505450 7:1388294-1388316 AGCCCCTGTGTGAAGGGTGAAGG - Intergenic
1019574125 7:1728087-1728109 GGCCCCTGGGTGGAGCAGGAAGG - Intronic
1019712950 7:2525667-2525689 GGACGCTGGGAGAAGGGAGAAGG - Exonic
1020398227 7:7742403-7742425 GGCTGCTGGAAGGTGGGTGACGG + Intronic
1020650994 7:10876102-10876124 GGAGGGTGGGAGGAGGGTGAGGG - Intergenic
1020987007 7:15148468-15148490 GGTCCATGGGAGGAGGATGAGGG - Intergenic
1021204296 7:17760901-17760923 GGAAGGTGGGAGGAGGGTGAGGG + Intergenic
1021547100 7:21826018-21826040 GGACCGTGGGAGGGGAGTGAGGG + Intronic
1021746357 7:23745177-23745199 GGCCCTTGGGAGGAGTGTTGAGG + Intronic
1022306789 7:29154161-29154183 GCCCCTGGGGAGGAGGGTGGTGG + Intronic
1022350920 7:29565736-29565758 AGCACCTGGGAGGAGGGCGCTGG - Intronic
1022943216 7:35258465-35258487 GGCCGCGGGGAGGAGCGAGAGGG - Intergenic
1023232762 7:38051456-38051478 GGCTCCTGGGAGGAGTGTTCAGG + Intergenic
1023785263 7:43701242-43701264 GGAGAGTGGGAGGAGGGTGAGGG - Intronic
1024235826 7:47397024-47397046 GGCTCCTGGCAGGAGGGTGGAGG - Intronic
1024962412 7:54991480-54991502 GGCCGCTGGGTGGAAGGTGATGG + Intergenic
1025242962 7:57293419-57293441 CTCCCCTGGGAGGTTGGTGAAGG - Intergenic
1025828754 7:65032400-65032422 GGAGGATGGGAGGAGGGTGAGGG + Intergenic
1025916276 7:65868809-65868831 GGAGGATGGGAGGAGGGTGAGGG + Intergenic
1026159393 7:67855383-67855405 GGGGCCTGGGGGGAGGGTGGGGG + Intergenic
1026442737 7:70458149-70458171 GGGCCCTGGCAGGAGGCTGCCGG + Intronic
1028184926 7:87771669-87771691 GGCCCCAGGGATGGGGGTGAAGG + Intronic
1028796394 7:94908072-94908094 GGCGCCTGCGAGGAGGGGGTGGG + Intronic
1029127389 7:98304060-98304082 GTCCCCGGGGAGGAGGGAGGAGG - Intronic
1029207467 7:98878335-98878357 GGCTCCTGGGAGGAGACTCAGGG + Intronic
1029359619 7:100079112-100079134 GGACCCTGCTAGGAGGGCGATGG - Exonic
1029458305 7:100681998-100682020 GGCAGCGGAGAGGAGGGTGAAGG + Intronic
1029496262 7:100896776-100896798 GGCCCCTCGGAGCAGGCTGGGGG - Intronic
1029506431 7:100966300-100966322 GGCCCCGCGGGGGCGGGTGAGGG - Intronic
1029544483 7:101203013-101203035 GTCCCCTGGGAAGAGGATGGTGG + Intergenic
1029627894 7:101731777-101731799 TGCCCCTGTGAAGAGGCTGAAGG - Intergenic
1029633719 7:101769750-101769772 GGCCCAGGGGAGGATGGTGGTGG - Intergenic
1029705629 7:102274325-102274347 GACCCATGGGAGGAGGGAGGAGG + Intronic
1031123022 7:117742692-117742714 GGACTGTGGGACGAGGGTGAGGG + Intronic
1031604068 7:123748446-123748468 GCACCCTGGGAGCAGGGCGAGGG + Intronic
1031986258 7:128166541-128166563 GGCCTTTGGGAGGAAGGGGAAGG + Intergenic
1032344113 7:131104192-131104214 GGACAATGGGAGGAGGGAGATGG + Intergenic
1033268007 7:139903081-139903103 GGAGAGTGGGAGGAGGGTGAGGG - Intronic
1033558067 7:142506371-142506393 GGGACCTGGGAGGAGGGTGTTGG + Intergenic
1033677377 7:143556487-143556509 GGCCCCTGGGAGGAGTGTTTAGG + Intergenic
1033694457 7:143772949-143772971 GGCCCCTGGGAGGAGTGTTTAGG - Intergenic
1034393179 7:150801264-150801286 GGGCCCTGGGAGGAGGATGAGGG + Exonic
1034433462 7:151052107-151052129 GGCCCCTAGGATGAGGGGGAAGG + Intronic
1034845304 7:154438943-154438965 GGCCCATGGGTGGAGGAGGAGGG + Intronic
1035175179 7:157045273-157045295 GGCCCTTGGGTGGAGGGTGGAGG + Intergenic
1035231291 7:157467570-157467592 GGCTCCTGGGAGCCGGGCGATGG + Intergenic
1035423860 7:158753817-158753839 AGCCCCTGGGAAGTGTGTGAAGG - Intronic
1035527211 8:323283-323305 GGCCCCTGGGAGCTGGCTGGGGG + Intergenic
1035759904 8:2061623-2061645 GGCTCCTGGGAGGAGGAAGCAGG - Intronic
1037754639 8:21702973-21702995 GTTCCCTGGGATGGGGGTGAGGG + Exonic
1037950521 8:23016313-23016335 GGCAGCAGGGAGGAGGGTCACGG - Intronic
1038646485 8:29366181-29366203 GGTCACTGGGTGGAGGGAGAGGG - Intergenic
1039005177 8:33028373-33028395 GGCCCCTGGGAAGTGTGTGCAGG - Intergenic
1039362016 8:36886785-36886807 GGACATTGGGAGGAGGATGAGGG - Intronic
1040065447 8:43140808-43140830 GGCCCCGCGGAGGCGGGGGAGGG + Intronic
1040459870 8:47636952-47636974 GAGCCTTGGCAGGAGGGTGAGGG + Intronic
1040860145 8:51990556-51990578 GGCACCTGGGAGCAGGGACATGG + Intergenic
1040883928 8:52238860-52238882 GGGGGGTGGGAGGAGGGTGAGGG + Intronic
1042459627 8:69048391-69048413 GGAGACTGGGAGGAGAGTGAGGG + Intergenic
1042673439 8:71289124-71289146 GGTCCCTGGAAGGAAGGGGAGGG + Intronic
1045112879 8:98949990-98950012 CGCACCTGGGTGGAGGGTGGGGG - Intronic
1047510732 8:125513393-125513415 GGTCTGTGGGAGGAGGATGAGGG + Intergenic
1047526556 8:125638819-125638841 GGCTTCAGGGAGGAGGGTGTCGG + Intergenic
1049176850 8:141197957-141197979 GGATCCTGGGATGAGGGAGAGGG + Intergenic
1049208426 8:141374252-141374274 GGCCCCTAGGAGGAGAGGGCAGG - Intergenic
1049231784 8:141488459-141488481 GGTGCCTGGGAGGAGGGGTAGGG - Intergenic
1049233571 8:141496649-141496671 GGGCCCTGGGAGGAGGGCAGGGG + Intergenic
1049246635 8:141566205-141566227 GGGCCCTTGAAGGCGGGTGAAGG + Intergenic
1049346787 8:142143536-142143558 TGCCTGTGGCAGGAGGGTGAGGG - Intergenic
1049644245 8:143728928-143728950 GGCCCCAGAGAAGGGGGTGAGGG + Intronic
1049675647 8:143887709-143887731 AGCCCCTGGGAGGAAGGGGCTGG + Intergenic
1049718931 8:144106760-144106782 GGCCCCAGGGAGGATGTTCAGGG - Intronic
1049732471 8:144185696-144185718 GGACCGTGGGGGGAGGGGGAGGG + Intronic
1049732508 8:144185780-144185802 GGACCGTGGGGGGAGGGGGAGGG + Intronic
1049732543 8:144185875-144185897 GGACCGTGGGGGGATGGTGAGGG + Intronic
1049784018 8:144441993-144442015 GGGCCCTGGGAGGTGTGTGCAGG - Intronic
1049826188 8:144670356-144670378 TGGCCCGGTGAGGAGGGTGATGG - Intergenic
1049844601 8:144793663-144793685 GGACCCTGGGGGCAGGGTGAGGG + Intergenic
1050534760 9:6622272-6622294 GGCCCGTGGAAAGAGGGAGAGGG - Intronic
1050677446 9:8071676-8071698 GGCTCCTAGGAGGTGAGTGAAGG - Intergenic
1051201797 9:14634111-14634133 GGCCCCTGAGAGGAGTGTTCAGG - Intronic
1052462609 9:28785633-28785655 GGGCCCTGGGTGGCGGGGGAGGG - Intergenic
1052607067 9:30718063-30718085 GGAGGGTGGGAGGAGGGTGAGGG - Intergenic
1053142736 9:35691143-35691165 AGCCGCCGGGAGGAGGGGGAAGG + Intergenic
1053202835 9:36164487-36164509 GGCGCCTGGTAGGAAGCTGACGG + Intergenic
1053376007 9:37606931-37606953 GACTCCTGGGAGAAGGGAGAAGG + Intronic
1054407338 9:64773771-64773793 GGCACCGGGGAGGGGGGTGGGGG + Intergenic
1055805365 9:80087119-80087141 CGCCCCTAGGAGGAAGGAGAGGG - Intergenic
1056299371 9:85226092-85226114 AGCCTCAGGGAGTAGGGTGAGGG - Intergenic
1056854701 9:90116163-90116185 GGCCCAGGGAAGGAGAGTGAGGG - Intergenic
1057226678 9:93296506-93296528 GGCCAAGGGGAGGAAGGTGAGGG - Intronic
1057230931 9:93320856-93320878 GGTGCCTGGGAGGTGGGTGTGGG - Intronic
1057915687 9:99053469-99053491 CTCCCCTGGAAGGAGGGGGAGGG + Intronic
1058545814 9:106059607-106059629 GGCTCCTGGGTGGAAGGGGATGG - Intergenic
1058727945 9:107821422-107821444 GGCCTCTTGGAGGAGGGTCAAGG + Intergenic
1060731180 9:126038011-126038033 GCCCCGTGGGAGGAGGGTTCTGG + Intergenic
1060733056 9:126050011-126050033 GTCCCCTGGGACGGGGGTGGGGG + Intergenic
1060927102 9:127462666-127462688 GGCCTGTCGGAGGAGGGTGGTGG + Intronic
1061000319 9:127899087-127899109 GGCTCCAGGGAGAAGGGGGAGGG + Intronic
1061247510 9:129408281-129408303 GGATCCAGGGAGCAGGGTGAGGG - Intergenic
1061248481 9:129413575-129413597 GGCACCGGGGAGGAGGGGGAAGG + Intergenic
1061517535 9:131098282-131098304 GCCCCCAGGAAGCAGGGTGAGGG - Intronic
1061757337 9:132824301-132824323 GGGCCTTGGCAGGAGGGGGAAGG - Intronic
1061884386 9:133584238-133584260 GTCCCCAGGGAGGAGGCTGAAGG - Intronic
1061893187 9:133633452-133633474 GTCACCTCTGAGGAGGGTGAGGG + Intergenic
1061959530 9:133980974-133980996 GATCCCTGGGGGCAGGGTGATGG - Intronic
1061987985 9:134141325-134141347 GGACCCTGGGAGGGAGGGGAAGG + Intronic
1062035398 9:134380496-134380518 CCCCCCTGGGAGGAGGCTGCAGG + Intronic
1062344641 9:136109218-136109240 GGCCCAGGGGAGGAGGGCGCCGG - Intergenic
1062360601 9:136186225-136186247 GTGCCCTGGGAGGGGGGTGTGGG - Intergenic
1062522490 9:136964056-136964078 GGCACCTGGGAGTTGGGGGAGGG + Intergenic
1062535698 9:137020249-137020271 GACCCCTGGGCAGAGGGTGTCGG - Intronic
1062654016 9:137592764-137592786 GTCCCCTTGCAGCAGGGTGAAGG - Intergenic
1203470060 Un_GL000220v1:112323-112345 GGCCCGCGGGGGGAGGGGGAAGG - Intergenic
1203477881 Un_GL000220v1:156295-156317 GGCCCGCGGGGGGAGGGGGAAGG - Intergenic
1203360549 Un_KI270442v1:217085-217107 GGCCTGTGGGGGGAGGGAGAAGG + Intergenic
1185874231 X:3688971-3688993 GGCACCTGGGTGGAAGGAGAGGG + Intronic
1187442023 X:19329197-19329219 AGCCCCTGGCTGGAGAGTGAGGG - Intergenic
1187522875 X:20028975-20028997 TTCCACGGGGAGGAGGGTGAGGG - Intronic
1187717883 X:22121468-22121490 GGAGGCTGGGAGGAGGGTAAGGG + Intronic
1188080320 X:25830928-25830950 GGAGACTGGGAGGGGGGTGAGGG - Intergenic
1188194880 X:27221431-27221453 GGAGAGTGGGAGGAGGGTGAGGG - Intergenic
1188268396 X:28107449-28107471 GTCCCTTGGGGTGAGGGTGAGGG + Intergenic
1188880316 X:35484412-35484434 GGAGTCTGGGAGGAGGGAGAGGG - Intergenic
1189726311 X:43970624-43970646 GGCCCCTGGGAAGAAGCTGTTGG - Intronic
1190223827 X:48530577-48530599 GGCTGCTGGGATGGGGGTGAAGG - Intergenic
1190493858 X:51008540-51008562 GGCCCCTGGCAGGAGGGTTTGGG - Intergenic
1190510900 X:51173490-51173512 GGCCCCTGGCAGGAGGGTTTGGG + Intergenic
1191016336 X:55813727-55813749 GGCTCCTGGGAGGAAAGGGATGG + Intergenic
1191740522 X:64432509-64432531 GGCCCCAGGGATGAGGCTGATGG - Intergenic
1195923244 X:110002839-110002861 GGCGCCGGGGAGGAGGGAGGGGG + Intronic
1196486008 X:116207850-116207872 GGAGGATGGGAGGAGGGTGAGGG + Intergenic
1197098864 X:122627747-122627769 GGCCCCTGGGATGAGTTTGGAGG - Intergenic
1197520083 X:127486433-127486455 GGCACCTGGGAGCAGGGACATGG + Intergenic
1197722782 X:129756245-129756267 GTCCCCAGGGAGGAGAGAGAGGG - Intronic
1198049529 X:132936706-132936728 GGAGACTGGGAGGAGGATGAGGG + Intronic
1198299170 X:135317688-135317710 GGCCCCTGGGAGGAGTATTCAGG + Intronic
1199209896 X:145195522-145195544 AGGCCTTTGGAGGAGGGTGAGGG - Intergenic
1199973830 X:152879810-152879832 GGCCACAGGGTGGAGGATGAAGG - Intergenic
1200105118 X:153707733-153707755 GGGCCCTGGGTGGGGGTTGAGGG - Intronic
1200235085 X:154464268-154464290 AGCTCCTGGAGGGAGGGTGAGGG - Exonic