ID: 934780981

View in Genome Browser
Species Human (GRCh38)
Location 2:96969560-96969582
Sequence CTTGTCGGTGTGCCTGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934780981_934780984 -9 Left 934780981 2:96969560-96969582 CCAATGCCAGGCACACCGACAAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 934780984 2:96969574-96969596 ACCGACAAGCAGTCACGAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934780981 Original CRISPR CTTGTCGGTGTGCCTGGCAT TGG (reversed) Intronic
900538179 1:3189232-3189254 CTTGTTGGTGTGAGTGGCTTGGG - Intronic
905703396 1:40036336-40036358 CTTGTCTGTTTCCCTGGCAAAGG - Intergenic
906098315 1:43239160-43239182 CTGGTCACTGTGCCAGGCATGGG - Intronic
912682338 1:111737409-111737431 TTTGTGGGTGTTCCTGGCATGGG - Intronic
913229423 1:116729565-116729587 CTTGTTGGTGTGCTTTTCATAGG + Intergenic
919554850 1:199038360-199038382 GTTGTCAGTGGTCCTGGCATAGG - Intergenic
921746762 1:218749458-218749480 CTTCTGGGTGTGACTGGAATGGG + Intergenic
921776726 1:219109825-219109847 CTTGTGGGAGGGACTGGCATGGG + Intergenic
1074634214 10:115295377-115295399 CCTGTGGGTGTGCCTGCCAGGGG + Intronic
1075784361 10:125038820-125038842 CTTGGCCGTGGGCCTGGCCTTGG - Intronic
1077904401 11:6518555-6518577 CTTGACACAGTGCCTGGCATGGG - Intronic
1089655913 11:119946881-119946903 CTTTACTATGTGCCTGGCATTGG - Intergenic
1090264796 11:125347131-125347153 CTTGTCCTTGTGCCAGCCATGGG + Intronic
1090909955 11:131110220-131110242 CTTGTGGGTGTGCCAGAGATGGG + Intergenic
1091128155 11:133120456-133120478 CTTGAAGCTGTGTCTGGCATGGG - Intronic
1091383318 12:76935-76957 CTTGTCTCTCTGCCTGGGATGGG - Intronic
1097566873 12:61281175-61281197 CTTGGCATGGTGCCTGGCATGGG + Intergenic
1103458758 12:121087497-121087519 CCTATGGGTGTGGCTGGCATGGG - Intergenic
1105669142 13:22593027-22593049 CTTGTGGCTTTGCCTGGCAGTGG - Intergenic
1105700870 13:22935127-22935149 CTTCTCGGAGTGCCTGGTCTGGG + Intergenic
1105853692 13:24358184-24358206 CTTCTCGGAGTGCCTGGTCTGGG + Intergenic
1111242186 13:85489427-85489449 GTTGTTGGAGTGCCTGGGATTGG - Intergenic
1116574665 14:46557641-46557663 CTGGTGTGTGTGCCTGCCATTGG - Intergenic
1118164537 14:63323413-63323435 CTTGTCTGTGTGACTGCCCTGGG - Intergenic
1118394200 14:65321959-65321981 CTTTTGGGTTTGCCTGGCAATGG + Intergenic
1118734504 14:68691777-68691799 CTGGTCTCTGTGCCTGGCACCGG + Intronic
1120404337 14:84075687-84075709 CTTGATCATGTGCCTGGCATTGG + Intergenic
1122143628 14:99676349-99676371 CTTGTGGGTGCTCCTGGGATGGG + Exonic
1123050048 14:105537006-105537028 CCTGTCGGTGTGGCTGGCTTCGG - Intergenic
1128065896 15:64764229-64764251 CCTGCCTGTGTGCCTGGCAAGGG + Intronic
1128716679 15:69913798-69913820 CATGTGGATGTGCCTGGCACAGG + Intergenic
1134265301 16:12687495-12687517 ATTGCAGGTGTGCCTGGCCTAGG - Intronic
1136774902 16:32866739-32866761 CTTTTCAGTGTGCCAGGTATGGG + Intergenic
1141443981 16:84046478-84046500 TTTGCGGGTGGGCCTGGCATCGG - Intergenic
1203077321 16_KI270728v1_random:1128848-1128870 CTTTTCAGTGTGCCAGGTATGGG + Intergenic
1144714208 17:17422851-17422873 CTCGCCTGTGTGCCTGGCAGAGG + Intergenic
1145968525 17:28939190-28939212 CTTGTTGTTTTGCCTGGCATGGG - Intronic
1148859063 17:50594685-50594707 ATTAAGGGTGTGCCTGGCATGGG - Intronic
1148956081 17:51354811-51354833 CCTGGCACTGTGCCTGGCATGGG - Intergenic
1151436934 17:74103519-74103541 CTTTCCAGTGTGCCTTGCATGGG - Intergenic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1152590074 17:81207290-81207312 CTGGTCTGTGTGCCTAGCGTCGG - Intronic
1155096493 18:22560459-22560481 CTTATCGGTGGGCTTTGCATAGG + Intergenic
1155319746 18:24607570-24607592 CTTGTCTTGGTGCCTGGCACAGG - Intergenic
1157304617 18:46507886-46507908 CTGTCCTGTGTGCCTGGCATGGG + Intronic
1157470046 18:47982141-47982163 TTGGTCTGTGTGCCTGGTATGGG - Intergenic
1159910963 18:74146391-74146413 CCTGTCATTATGCCTGGCATGGG - Intronic
1160752034 19:738887-738909 CTGGGGGGTGTGCCAGGCATTGG + Intronic
1160982599 19:1823248-1823270 CATGTCGGGGTACCTGGCATTGG - Intronic
1161126437 19:2560549-2560571 CTTGGGGGTGCTCCTGGCATGGG + Intronic
1164478877 19:28596300-28596322 GTTGTCGATGTGGCTGGAATCGG - Intergenic
1165108191 19:33486713-33486735 CTACTCGGGGTGCCTGGCCTGGG - Intronic
925589361 2:5494101-5494123 CTTGTCCGTGGTCCTGGCAGGGG - Intergenic
925638695 2:5967228-5967250 CTGGGTGGTGTGCATGGCATTGG + Intergenic
927384312 2:22515629-22515651 CCTGTTGGTGTGCCTGGTTTTGG - Intergenic
927900098 2:26812841-26812863 CTTCACTATGTGCCTGGCATAGG + Intergenic
933141463 2:78795902-78795924 CTTGTGTGTGTGCCTGCTATGGG + Intergenic
933981138 2:87551950-87551972 CTTGTCCCTGTGCCTGGGAAGGG + Intergenic
934780981 2:96969560-96969582 CTTGTCGGTGTGCCTGGCATTGG - Intronic
934785475 2:97002256-97002278 CTTATCCAAGTGCCTGGCATGGG - Intronic
936057241 2:109270306-109270328 CCTGTTGGAGTGCCGGGCATGGG + Intronic
937572122 2:123376991-123377013 CTTGTCTGTGTTCCTGGGAAAGG - Intergenic
941562147 2:167059803-167059825 CTTGGCGGTGTGCCTTGCCTTGG + Intronic
1169339728 20:4787172-4787194 CTTGTCCATGTGACTGGCTTTGG + Intronic
1170861204 20:20105233-20105255 CTTCTCATTGTTCCTGGCATGGG + Intronic
1175608161 20:60328418-60328440 CTTGTCTGTGTGTCTGGTAGTGG + Intergenic
1176208877 20:63907379-63907401 ATTAACTGTGTGCCTGGCATAGG + Intronic
1176281861 20:64317851-64317873 CTTGTCTCTCTGCCTGGGATGGG + Intergenic
1178924865 21:36766587-36766609 CATGTGGGTGAGCCTGGCACTGG + Intronic
1179556832 21:42184327-42184349 GTAGTCTGTGTGCATGGCATGGG + Intergenic
1180125617 21:45788224-45788246 GTGGGCGGCGTGCCTGGCATGGG + Intronic
1184307408 22:43615272-43615294 CTTGTAGGTCTGGCTGTCATTGG + Intronic
1184433334 22:44454441-44454463 GTGGTCCGTGTGCCTGGGATGGG - Intergenic
951238073 3:20257945-20257967 CTGGTCTTTGTGCCTGCCATTGG - Intergenic
952899410 3:38099733-38099755 TTTGTGTGTGTGCCTGGCATGGG + Intronic
955996660 3:64686155-64686177 CTTATTGGTGCGCCTTGCATCGG - Intronic
956726691 3:72162433-72162455 CTTGGGGCTGTGCCAGGCATAGG - Intergenic
960018706 3:112923764-112923786 CTTCTCTGTGTAGCTGGCATAGG + Exonic
961543928 3:127618975-127618997 ATTGTGGGTGTGCGTGGCTTTGG - Intronic
965609698 3:170531154-170531176 TTTGTCATTATGCCTGGCATGGG - Intronic
966413517 3:179666656-179666678 CTTGGCAGGGTGCCTGGCACAGG + Intronic
969497787 4:7535797-7535819 CTGGTGGCTGTGCCAGGCATGGG + Intronic
972044002 4:34640139-34640161 CTGGTCTTTGTGCCTGTCATGGG + Intergenic
975893765 4:79061514-79061536 GATGCCTGTGTGCCTGGCATTGG + Intergenic
983474426 4:168196436-168196458 ATTGGCGGTGTGCCAGACATTGG + Intergenic
985818233 5:2142587-2142609 CTTGCCGATGTCGCTGGCATGGG + Intergenic
986976002 5:13394808-13394830 CTAGTGGGTGTGCCTGGGAGGGG - Intergenic
987266749 5:16263604-16263626 ATTGTCCCTTTGCCTGGCATGGG - Intergenic
988828715 5:34967329-34967351 CTGGACAGTGTGCATGGCATTGG + Intergenic
989369594 5:40692154-40692176 CTTCCAGGTGTGCCTGGCATGGG + Exonic
995856586 5:116598935-116598957 CTGGACAGTGTGCCTGGCTTAGG - Intergenic
998181645 5:139950217-139950239 ATCGTCTGTGTCCCTGGCATTGG - Intronic
998910661 5:146956583-146956605 CTGGTCTGTGTGTTTGGCATGGG - Intronic
1007786375 6:44282236-44282258 CTTGTTGGTCTGCAAGGCATGGG + Exonic
1014225459 6:118841511-118841533 CTTGTTGATCTGCCTGGCTTAGG - Intronic
1018425760 6:163679123-163679145 GTTTTCGGTGTGCCTTTCATGGG + Intergenic
1018980599 6:168598982-168599004 CTTGTGGATGTGCCGGGAATGGG - Exonic
1019366924 7:638088-638110 GTTGTCTGTGTGCCTGGCCCAGG + Intronic
1023816111 7:43951249-43951271 CATGTGGTTGTGCCTGGCCTAGG - Intronic
1031257023 7:119466093-119466115 CTTGGCCCTGTGCCTGGCACAGG - Intergenic
1032423108 7:131799076-131799098 CTTGTCTGTGCTACTGGCATTGG + Intergenic
1035158005 7:156929892-156929914 CTTCTCCGTGTGCCAGGCAGGGG - Intergenic
1038329051 8:26593317-26593339 GTTCTAGGTGGGCCTGGCATTGG + Intronic
1038542460 8:28401705-28401727 CGTGTCTGTGTGTGTGGCATGGG + Intronic
1038610590 8:29057058-29057080 TTGGTCGGTGTGGCTGGCGTGGG + Intronic
1040611047 8:48982616-48982638 CCTGTCGCTGTGCCTGGGAATGG + Intergenic
1044277309 8:90316850-90316872 GTTGTCGCTGTGCCTGGCAGTGG - Intergenic
1044297120 8:90541682-90541704 CTTGACTGTGTTCCTTGCATTGG - Intergenic
1056127040 9:83544355-83544377 CTTGTGCTTGTGCTTGGCATTGG + Intergenic
1058975395 9:110121414-110121436 CTTCTCTGTGTGCCTTGAATTGG + Intronic
1061019306 9:128003868-128003890 CATGTCGGTGTTGCTGCCATGGG + Intergenic
1062302759 9:135884721-135884743 CTTCCCGTTGTGCTTGGCATTGG - Intronic
1198435964 X:136617102-136617124 CTTGAAGGTGGGCCTGGAATTGG - Intergenic
1200105035 X:153707319-153707341 CTTTTCAGTGTGCCAGGTATGGG - Intronic