ID: 934781002

View in Genome Browser
Species Human (GRCh38)
Location 2:96969692-96969714
Sequence TCCCATTAGATTGTACGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 58}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934781002_934781006 20 Left 934781002 2:96969692-96969714 CCCTAACGTACAATCTAATGGGA 0: 1
1: 0
2: 1
3: 4
4: 58
Right 934781006 2:96969735-96969757 AGCTGAACAACACAAGTTCCCGG 0: 1
1: 0
2: 2
3: 9
4: 110
934781002_934781009 28 Left 934781002 2:96969692-96969714 CCCTAACGTACAATCTAATGGGA 0: 1
1: 0
2: 1
3: 4
4: 58
Right 934781009 2:96969743-96969765 AACACAAGTTCCCGGGTCGGAGG 0: 1
1: 0
2: 0
3: 3
4: 32
934781002_934781005 -3 Left 934781002 2:96969692-96969714 CCCTAACGTACAATCTAATGGGA 0: 1
1: 0
2: 1
3: 4
4: 58
Right 934781005 2:96969712-96969734 GGAGAAAATCACTCAGGTGAAGG 0: 1
1: 0
2: 3
3: 21
4: 251
934781002_934781007 21 Left 934781002 2:96969692-96969714 CCCTAACGTACAATCTAATGGGA 0: 1
1: 0
2: 1
3: 4
4: 58
Right 934781007 2:96969736-96969758 GCTGAACAACACAAGTTCCCGGG 0: 1
1: 0
2: 0
3: 8
4: 91
934781002_934781008 25 Left 934781002 2:96969692-96969714 CCCTAACGTACAATCTAATGGGA 0: 1
1: 0
2: 1
3: 4
4: 58
Right 934781008 2:96969740-96969762 AACAACACAAGTTCCCGGGTCGG 0: 1
1: 0
2: 1
3: 4
4: 62
934781002_934781004 -9 Left 934781002 2:96969692-96969714 CCCTAACGTACAATCTAATGGGA 0: 1
1: 0
2: 1
3: 4
4: 58
Right 934781004 2:96969706-96969728 CTAATGGGAGAAAATCACTCAGG 0: 1
1: 0
2: 1
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934781002 Original CRISPR TCCCATTAGATTGTACGTTA GGG (reversed) Intronic
905554919 1:38874581-38874603 ACCAATGAGATTGTTCGTTAGGG + Exonic
911111512 1:94192542-94192564 TCCCATAAGATTGTGTCTTAGGG - Intronic
911882529 1:103259446-103259468 TCCCACTAGACTGTAAGCTATGG - Intergenic
920892920 1:210010660-210010682 TCCCATTAGGTTGAATTTTAGGG + Intronic
923446260 1:234074175-234074197 TCCCTTTAAAATGTACGTCAAGG + Intronic
1066092532 10:32038942-32038964 TCCCATTAGAATGTGAGCTATGG - Intronic
1096172573 12:49484978-49485000 TCCTATTCGATTGTTCCTTAAGG - Intronic
1099722023 12:86375986-86376008 TGCAAATAGATTGAACGTTAAGG + Intronic
1106221656 13:27750812-27750834 TTCCATGAGATTGTGTGTTAGGG - Intergenic
1120538618 14:85727936-85727958 TTCCATTAAATTCTACTTTAGGG - Intergenic
1122443438 14:101750550-101750572 CCCCATTAGAATGTAGGTTTTGG + Intergenic
1122474172 14:101994979-101995001 TCACCTTAGATTGTACCTGAGGG - Exonic
1122841249 14:104464692-104464714 TCCCATTGAATTGAAAGTTAGGG - Intergenic
1140461610 16:75144520-75144542 TTCCATAAGATTATAGGTTATGG + Intergenic
1140777384 16:78262613-78262635 TCTCATTAGATTATACTTCATGG - Intronic
1141559315 16:84856421-84856443 TCCCATTAAACTGGAAGTTAAGG - Intronic
1144851184 17:18244759-18244781 TCCCTGTAGATTGTACCTTGGGG + Exonic
1150912509 17:69403183-69403205 AGACATTAGATTGTACTTTACGG - Intergenic
1165988567 19:39792230-39792252 TCCCATTAGATTTGACATTATGG - Intergenic
925842058 2:8001740-8001762 TCCCATCACATTGGAGGTTAGGG - Intergenic
928878332 2:36067506-36067528 TACCATTAGATTGTACAACATGG + Intergenic
929055980 2:37876100-37876122 TCCCACTAGACTGTAAGTTCAGG - Intergenic
932544793 2:72697053-72697075 TCTCATTAGCTAGTATGTTAAGG - Intronic
934781002 2:96969692-96969714 TCCCATTAGATTGTACGTTAGGG - Intronic
937467655 2:122148876-122148898 TACCATCACATTGGACGTTAGGG - Intergenic
939302857 2:140368865-140368887 TCCCATATGAATGTACCTTAAGG - Intronic
941737291 2:168992953-168992975 CCACATTAGATAGCACGTTATGG - Intronic
944482478 2:200172054-200172076 TCCCATTAGATGGTGGGTTGGGG - Intergenic
1175601267 20:60275271-60275293 TCCCATTAAAATCTTCGTTAAGG - Intergenic
1176989724 21:15480837-15480859 TCCCATTAGATTGTAAGGTCTGG - Intergenic
1180920783 22:19520525-19520547 TTCATTTAGATTGTAAGTTATGG + Exonic
1185005106 22:48271207-48271229 TACCATTACATTGGACGTTAGGG + Intergenic
956601610 3:71028750-71028772 TCCCAACTGATTCTACGTTAGGG - Intronic
959892927 3:111576954-111576976 TCTCCTTATATTGTAGGTTACGG + Intronic
961051677 3:123752177-123752199 TCCCATTAGATTGGAAGGTCCGG + Intronic
967205404 3:187115475-187115497 TACCATTAGATTTTACATTTAGG + Intergenic
971710278 4:30102157-30102179 TTCCATTAGATTGTAATTTGTGG - Intergenic
972701176 4:41495335-41495357 ACCCATTAGATTGTACAGTTAGG - Intronic
974874401 4:67685627-67685649 TCCCATTAGGTCCTACGTAACGG - Intronic
977051626 4:92135483-92135505 TCCCATTAGATGGTGGGTGAAGG + Intergenic
981373112 4:143983385-143983407 TCCCATTAGATTGTAAGCTCCGG - Intergenic
982460557 4:155664636-155664658 TCCAACAAGATTGTAGGTTATGG + Intergenic
992095526 5:73359038-73359060 TGCCATTACATTGTGGGTTAGGG + Intergenic
994011027 5:94902410-94902432 TCTCATTAGTTAGTACTTTAAGG - Intronic
994313686 5:98307378-98307400 TCCCACTAGATTGTAATTTTAGG + Intergenic
996050531 5:118927217-118927239 TACCATTATATTGGAAGTTAGGG + Intronic
999428927 5:151509681-151509703 TCCCAACTGATTCTACGTTATGG + Intronic
1000712353 5:164596369-164596391 TCCCATTAGACTGAACTCTATGG + Intergenic
1010168584 6:72946671-72946693 TTCAATTAGATTGAATGTTAAGG - Intronic
1018657090 6:166047633-166047655 TCCCATTAGATTTCAAGCTATGG - Intergenic
1018827081 6:167416181-167416203 TCCCATTACAATGTAGGTCAAGG - Intergenic
1025824361 7:64998551-64998573 TCCCATTAGAATGTATGTTAAGG - Intronic
1028606604 7:92662541-92662563 TCTCATGACATTGTACATTAGGG - Intronic
1031859266 7:126958763-126958785 TCCCTTTAGATTATTCTTTAAGG - Intronic
1044889962 8:96824517-96824539 TTCCATTGGATTGTAGGGTAAGG - Intronic
1052409110 9:28100089-28100111 TCCCATTAGATTGAAAGCTCTGG + Intronic
1052672997 9:31581960-31581982 TCCCATGAGGTTGTAATTTATGG + Intergenic
1059163459 9:112056993-112057015 TACCATCACATTGTAGGTTAGGG - Intronic
1060047943 9:120355471-120355493 TACAATTACATTGTACATTACGG + Intergenic
1189734623 X:44057322-44057344 TCCAATTAAAATGTACATTATGG + Intergenic
1197458552 X:126709215-126709237 TCCCACTTGATTCTACATTATGG - Intergenic
1198327871 X:135592206-135592228 TCCAGTTAGATTGTACGACAGGG - Intergenic
1201798482 Y:17927160-17927182 TCCCAGTAGACTGAACGTCAAGG + Intergenic
1201803071 Y:17978797-17978819 TCCCAGTAGACTGAACGTCAAGG - Intergenic