ID: 934790862

View in Genome Browser
Species Human (GRCh38)
Location 2:97058947-97058969
Sequence TTGACTCTTTAGCAGTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934790862_934790867 4 Left 934790862 2:97058947-97058969 CCCACATACTGCTAAAGAGTCAA No data
Right 934790867 2:97058974-97058996 GAAAGTGGCATCGATGGTGCAGG No data
934790862_934790866 -2 Left 934790862 2:97058947-97058969 CCCACATACTGCTAAAGAGTCAA No data
Right 934790866 2:97058968-97058990 AAAGAGGAAAGTGGCATCGATGG No data
934790862_934790868 5 Left 934790862 2:97058947-97058969 CCCACATACTGCTAAAGAGTCAA No data
Right 934790868 2:97058975-97058997 AAAGTGGCATCGATGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934790862 Original CRISPR TTGACTCTTTAGCAGTATGT GGG (reversed) Intergenic
No off target data available for this crispr