ID: 934791352

View in Genome Browser
Species Human (GRCh38)
Location 2:97064670-97064692
Sequence TTGTAAGTGCATAAAACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934791350_934791352 -10 Left 934791350 2:97064657-97064679 CCAAACCATAACTTTGTAAGTGC No data
Right 934791352 2:97064670-97064692 TTGTAAGTGCATAAAACTGAAGG No data
934791348_934791352 13 Left 934791348 2:97064634-97064656 CCTTTTAAACGTAAGTTCCAATT 0: 22
1: 345
2: 513
3: 592
4: 663
Right 934791352 2:97064670-97064692 TTGTAAGTGCATAAAACTGAAGG No data
934791347_934791352 14 Left 934791347 2:97064633-97064655 CCCTTTTAAACGTAAGTTCCAAT No data
Right 934791352 2:97064670-97064692 TTGTAAGTGCATAAAACTGAAGG No data
934791349_934791352 -4 Left 934791349 2:97064651-97064673 CCAATTCCAAACCATAACTTTGT No data
Right 934791352 2:97064670-97064692 TTGTAAGTGCATAAAACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934791352 Original CRISPR TTGTAAGTGCATAAAACTGA AGG Intergenic
No off target data available for this crispr