ID: 934791572 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:97066859-97066881 |
Sequence | TCCCTTTGGTTGGGCACCAG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
934791567_934791572 | 11 | Left | 934791567 | 2:97066825-97066847 | CCAATTTCTTCTTCATTGTTGGA | No data | ||
Right | 934791572 | 2:97066859-97066881 | TCCCTTTGGTTGGGCACCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
934791572 | Original CRISPR | TCCCTTTGGTTGGGCACCAG TGG | Intergenic | ||