ID: 934791572

View in Genome Browser
Species Human (GRCh38)
Location 2:97066859-97066881
Sequence TCCCTTTGGTTGGGCACCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934791567_934791572 11 Left 934791567 2:97066825-97066847 CCAATTTCTTCTTCATTGTTGGA No data
Right 934791572 2:97066859-97066881 TCCCTTTGGTTGGGCACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934791572 Original CRISPR TCCCTTTGGTTGGGCACCAG TGG Intergenic