ID: 934794653

View in Genome Browser
Species Human (GRCh38)
Location 2:97090322-97090344
Sequence GGCTCTGTAGAGACCAGAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 3, 1: 0, 2: 1, 3: 24, 4: 245}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934794642_934794653 26 Left 934794642 2:97090273-97090295 CCAGGAAGGTTACCTCCGACCAT 0: 1
1: 2
2: 0
3: 1
4: 45
Right 934794653 2:97090322-97090344 GGCTCTGTAGAGACCAGAGCAGG 0: 3
1: 0
2: 1
3: 24
4: 245
934794647_934794653 11 Left 934794647 2:97090288-97090310 CCGACCATGGTAGGACTGGCAAC 0: 2
1: 2
2: 0
3: 6
4: 59
Right 934794653 2:97090322-97090344 GGCTCTGTAGAGACCAGAGCAGG 0: 3
1: 0
2: 1
3: 24
4: 245
934794649_934794653 7 Left 934794649 2:97090292-97090314 CCATGGTAGGACTGGCAACTGGG 0: 4
1: 0
2: 0
3: 10
4: 196
Right 934794653 2:97090322-97090344 GGCTCTGTAGAGACCAGAGCAGG 0: 3
1: 0
2: 1
3: 24
4: 245
934794646_934794653 14 Left 934794646 2:97090285-97090307 CCTCCGACCATGGTAGGACTGGC 0: 1
1: 2
2: 0
3: 4
4: 40
Right 934794653 2:97090322-97090344 GGCTCTGTAGAGACCAGAGCAGG 0: 3
1: 0
2: 1
3: 24
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934794653 Original CRISPR GGCTCTGTAGAGACCAGAGC AGG Exonic
900093144 1:929240-929262 TGCTCTGCAGGGACCACAGCGGG + Intronic
900413856 1:2526214-2526236 GGCGCCGCAGGGACCAGAGCGGG - Intronic
900653252 1:3741736-3741758 TGCTCTGGAGAGCTCAGAGCAGG + Intergenic
900859404 1:5217448-5217470 GCCTCTGTGGAGAGCAGAGCAGG - Intergenic
901238450 1:7679835-7679857 GGCCCTGCAGAGAGCAGATCAGG + Intronic
901987766 1:13089755-13089777 GCTTCTGGAGTGACCAGAGCAGG - Intergenic
901994046 1:13137012-13137034 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
902402470 1:16165788-16165810 GGCTCTGTAGGGACCACCTCGGG + Intergenic
902926131 1:19696916-19696938 GGCTCTGTATGGTCCAGAGCCGG - Intronic
903131037 1:21279691-21279713 GGCTCTGCAGAGAGCCCAGCTGG - Intronic
903224089 1:21885154-21885176 GGCACTGAGGAGACCAGGGCAGG + Exonic
904872283 1:33626174-33626196 GGCACTGAAGAGACCAGCCCAGG - Intronic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
905629561 1:39511108-39511130 GGCTCTGGAGGGGGCAGAGCTGG - Intronic
905668198 1:39775082-39775104 GGCTCTGGAGGGGGCAGAGCTGG + Intronic
907825546 1:58013419-58013441 GGCACTTCAGAGACCACAGCAGG + Intronic
910372909 1:86537051-86537073 GGCTCTGAAGAAACCCCAGCAGG + Intergenic
912176624 1:107165964-107165986 TGCTCTGTAGAGCCCTGGGCTGG + Intronic
913334889 1:117700377-117700399 AGCTATGGTGAGACCAGAGCTGG + Intergenic
914917869 1:151829455-151829477 AGCTCTGTAAAGACAAGAGAGGG + Exonic
916782824 1:168054291-168054313 GACTCTGCAGAGTCCCGAGCTGG + Intronic
916933638 1:169605294-169605316 GGGTCTGGAGAGAACAGGGCGGG - Intronic
918215883 1:182391776-182391798 GGCTCTGCAGAGTCGAGAGTGGG - Exonic
920013817 1:202889240-202889262 TGCGCAGTAGAGTCCAGAGCGGG - Intergenic
921234419 1:213110759-213110781 ATCTGTGTAGAGACCAGAGAGGG - Intronic
921714500 1:218403996-218404018 GGCTATACAAAGACCAGAGCAGG - Intronic
922107378 1:222524291-222524313 TCCACTGTAGAGAGCAGAGCTGG + Intronic
922218505 1:223539966-223539988 GGCTCTGTAGACTGTAGAGCAGG - Intronic
923102247 1:230826026-230826048 GGCCCTGGGGAGAGCAGAGCTGG + Intergenic
923928816 1:238669211-238669233 TGTTCTGGAGATACCAGAGCAGG - Intergenic
924823569 1:247517908-247517930 GGTTCTGGAGAGGCCAAAGCTGG + Intronic
1062902350 10:1156011-1156033 GCCTCTGCAGAAACCATAGCAGG - Intergenic
1063620737 10:7646154-7646176 GCATCTGTAGAAATCAGAGCTGG - Intronic
1064413831 10:15131569-15131591 GGCTTTGAGCAGACCAGAGCTGG + Intronic
1066567035 10:36731524-36731546 GGATTTGAAGAGTCCAGAGCAGG - Intergenic
1067142001 10:43666161-43666183 GACTCTGCAGAGCCCAGAGGTGG + Intergenic
1067581716 10:47450580-47450602 GGCCCTTTAGAAACCTGAGCAGG + Intergenic
1067942209 10:50666712-50666734 GGCTCTGTAGAGACAAGTGAGGG + Intergenic
1069691694 10:70357875-70357897 GGCTCTAAAGGGACCACAGCTGG + Intronic
1070798085 10:79228763-79228785 GGCTATGTAGAGCCCAGTGCTGG + Intronic
1070863450 10:79691670-79691692 GGCTCTGTAGAGACAAGTGAGGG + Intergenic
1072617074 10:97057027-97057049 GGCTCTGCAGAGGCTAGAGAAGG - Intronic
1072916007 10:99537602-99537624 GGAGCTGTAGAGACCCGAGGAGG + Intergenic
1073151198 10:101312814-101312836 GGCTCTCTAGGTCCCAGAGCTGG - Intergenic
1075855697 10:125627825-125627847 GGCACTGCAGAGCCCAGAGGAGG + Intronic
1076701132 10:132273387-132273409 GGCTTTGTTGAGAACAGATCTGG - Intronic
1076992989 11:285211-285233 GGCTGTGAAGAGAGCAAAGCCGG + Exonic
1077042834 11:532144-532166 GGCTATGGAGAGCCCAGGGCTGG + Intergenic
1077535344 11:3121478-3121500 GGCTCTGCAGACACCAGGGCTGG + Intronic
1077797488 11:5507796-5507818 AGCTCTGCAGAGTCCAGTGCTGG + Exonic
1078583703 11:12561198-12561220 GGCACTGTGGAGACCAGAACTGG - Intergenic
1079875827 11:25856098-25856120 GACTCTGCAGAGTCCAGAGATGG - Intergenic
1080312595 11:30912147-30912169 GGCTCTCTAGAGCCCTGAGATGG - Intronic
1081245893 11:40765386-40765408 GGCTCTATAGAAAGCATAGCTGG - Intronic
1083162696 11:60865048-60865070 GGATCTGGGGAGAGCAGAGCTGG - Intergenic
1083644808 11:64165979-64166001 GGCTCTGTAGAGACATGAGCGGG + Exonic
1084033594 11:66494890-66494912 GGGTCTGGAGACACCAGATCTGG + Intronic
1084648005 11:70471903-70471925 AGCTCTGCAAAGATCAGAGCAGG - Intronic
1085803807 11:79616103-79616125 GGCTCTGGAGTGAGAAGAGCTGG - Intergenic
1086958943 11:92962446-92962468 GCCTCTGTGGAAGCCAGAGCTGG - Intergenic
1092905076 12:13093634-13093656 GGCTCTGTGGACACCAAACCTGG - Intronic
1095421354 12:42027732-42027754 GGCTCTGCAGTGACCGGAGCAGG - Intergenic
1097953894 12:65463681-65463703 TGCAGTGTAGAGACCAGAGCTGG + Exonic
1099413278 12:82358467-82358489 GGCTCAGTAGAGCTCCGAGCCGG - Exonic
1101338683 12:103821015-103821037 TGATCTGTTGTGACCAGAGCTGG - Intronic
1103560853 12:121792802-121792824 GAGTCTGCAGAGACCACAGCAGG + Intronic
1103898194 12:124288281-124288303 GGCCCTGTGGAAACCAGAGCTGG - Intronic
1104980335 12:132570632-132570654 GGGTCCGCAGAGACCACAGCAGG - Intronic
1107279885 13:38721540-38721562 GAGCCTGTATAGACCAGAGCTGG + Intronic
1112420082 13:99240717-99240739 GGCTGTGTTGAGGCCATAGCTGG - Intronic
1112454620 13:99547744-99547766 GGGTCAGCAGGGACCAGAGCTGG + Intronic
1113658130 13:112082991-112083013 GGCACTGTAGAAGCCACAGCAGG + Intergenic
1114163034 14:20190329-20190351 GGCCCAGGAGAGGCCAGAGCAGG - Intergenic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1115174721 14:30548931-30548953 GGCTCAGCAAAGACCAGAGAAGG - Intergenic
1118391769 14:65301966-65301988 GCCTCTGTAGCGACCAGCCCAGG + Intergenic
1118492645 14:66276609-66276631 GTCTCTGGAGAGAGCAGATCTGG - Intergenic
1118951388 14:70439439-70439461 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
1122078201 14:99248958-99248980 GGCCCTGTTGAGTCCAGAGTGGG - Intronic
1123027389 14:105433150-105433172 GGCTCAGGAGAGACCAGGGGTGG + Intronic
1124005439 15:25792355-25792377 GTCTTTGCAGAGAGCAGAGCAGG - Intronic
1125077351 15:35634599-35634621 GGCTCGTTAAAGACTAGAGCTGG - Intergenic
1126149694 15:45512490-45512512 GGGTGTGTAGAGACAAGAGCAGG + Intronic
1129243905 15:74268449-74268471 GGCTCTGGAGGTACCAGGGCTGG + Exonic
1129870330 15:78936115-78936137 GGCTGTGTAGAGACCAAATTAGG - Intronic
1131177964 15:90221595-90221617 GGGTCTGTAGGGACCAGGTCAGG - Exonic
1131524654 15:93143323-93143345 GGCACTGTAGAGATTAGAGGAGG - Intergenic
1132556746 16:575978-576000 AGCCCTGCAGAGACCAGGGCAGG - Intronic
1134037897 16:11045678-11045700 GGATCTGCAGAGACCTGATCCGG - Intronic
1134533099 16:15000419-15000441 GACACTGTAGAGATCAGAGCAGG - Intronic
1134694473 16:16213194-16213216 AGCTCTGTGGAGACTAAAGCAGG - Intronic
1134977359 16:18581437-18581459 AGCTCTGTGGAGACTAAAGCAGG + Intergenic
1135614264 16:23897215-23897237 TGCTCTGTAGAGCTCTGAGCAGG + Intronic
1136275925 16:29179577-29179599 GGCCCAGTGAAGACCAGAGCTGG + Intergenic
1136617966 16:31410352-31410374 GGCTGGGCAGAGACTAGAGCGGG - Intronic
1137253129 16:46754554-46754576 CTCTCTGTAGAGTCCAGAGGTGG - Intronic
1138492527 16:57384620-57384642 TGCTCTCTATGGACCAGAGCTGG - Exonic
1139853495 16:69964031-69964053 GACCCTGGAGAGACCAGAGGGGG + Exonic
1139862934 16:70040309-70040331 GACACTGTAGAGATCGGAGCAGG + Intergenic
1139882466 16:70186940-70186962 GACCCTGGAGAGACCAGAGGGGG + Exonic
1140370043 16:74408564-74408586 GACCCTGGAGAGACCAGAGGGGG - Intronic
1141058681 16:80843302-80843324 GGCTTTGCAGAGTCAAGAGCAGG + Intergenic
1141182013 16:81760202-81760224 GGCTATGTAGACTCCAGACCTGG - Intronic
1141960592 16:87404983-87405005 GGCTTTGTAAAGGCCAGACCTGG - Intergenic
1142080297 16:88145639-88145661 GGCCCAGTGAAGACCAGAGCTGG + Intergenic
1144424006 17:15124020-15124042 GGCTCTGTGGGCACAAGAGCAGG - Intergenic
1148809885 17:50283655-50283677 GGCTCTGCAGAGACAACTGCAGG - Intergenic
1148853780 17:50567563-50567585 GACTCTGTAGGGCCCAGAGCAGG - Intronic
1149218683 17:54389342-54389364 GGAGCTGTAGACACCAGAGCAGG + Intergenic
1149797780 17:59536736-59536758 GTCACTGTAGAGAATAGAGCAGG - Intergenic
1150002652 17:61451604-61451626 GGCTCTGTCAAGGCCCGAGCCGG + Intergenic
1151423821 17:74016606-74016628 GGCTTCGTAGAGGCCAGTGCTGG - Intergenic
1152226440 17:79095012-79095034 AGCTCCTTAGAGAGCAGAGCTGG + Intronic
1152460993 17:80442372-80442394 GGGCCTGTGGAGCCCAGAGCAGG + Intergenic
1152558028 17:81064267-81064289 GGCCCTGTAGTGCCCACAGCCGG + Intronic
1152574614 17:81134560-81134582 GGGGCTGTGGAGCCCAGAGCAGG - Intronic
1152919345 17:83058115-83058137 GCCTCTGTGGACACCAGGGCTGG - Intergenic
1153519907 18:5941886-5941908 GGCTCTGTAGACAGGAGGGCTGG - Intergenic
1160507971 18:79437766-79437788 AGCTCCGTTGAGAGCAGAGCAGG - Intronic
1161101671 19:2424707-2424729 AGCCCTGCAGAGCCCAGAGCTGG - Intronic
1162090893 19:8279334-8279356 GGCTCAGTAGAAACCAGCTCTGG - Intronic
1162093126 19:8294172-8294194 GGCTCAGTAGAAACCAGCTCTGG - Intronic
1162191838 19:8953236-8953258 GGCTCTGAAGGGACCAGCTCAGG - Exonic
1162817799 19:13207163-13207185 GACTCTGGAGAGGCCAGGGCTGG - Exonic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1164286107 19:23819283-23819305 GCTTCTGAAGTGACCAGAGCAGG + Intronic
1165358592 19:35319400-35319422 GGCTCTGGAGTGGCCAGTGCTGG - Intronic
1166127653 19:40725321-40725343 TGCTCTGTAGGGAGCAGAGCAGG - Exonic
1166423314 19:42654798-42654820 AGCTCTGGAGGGAGCAGAGCAGG + Intronic
1166959365 19:46488503-46488525 GGCTCTGTAGAGAGGAGGGCAGG - Intronic
1167154575 19:47730248-47730270 GGCTCCGTAGGGACCAAAGGAGG - Intronic
1167420240 19:49398454-49398476 GGCTCGCTAGAGCCCAGAGGCGG - Intronic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
924961946 2:43640-43662 GGGTCTGGAGGGATCAGAGCAGG + Intronic
925523528 2:4774640-4774662 GGCTCTGGAGAAACCAGTCCAGG + Intergenic
926369218 2:12163558-12163580 GGCACAGTGGAGACCAGACCAGG - Intergenic
926602033 2:14855337-14855359 TGCCCTGTAGACACCACAGCTGG - Intergenic
927707276 2:25304191-25304213 GGCTTTGGAGAGGGCAGAGCCGG + Intronic
928799142 2:35065752-35065774 GCCTCTGTTGAGACCTGAGAGGG - Intergenic
928802908 2:35115753-35115775 TGCCCTGTAGCCACCAGAGCTGG - Intergenic
929070622 2:38027143-38027165 GGCTATGGGGAGACCAAAGCAGG - Intronic
930601673 2:53451137-53451159 GGCTCTGAAGAGGCCCGAGGAGG + Intergenic
931644182 2:64406508-64406530 GCCTCTGTAGAGCTGAGAGCTGG + Intergenic
934576776 2:95406922-95406944 GGCTCTGTAGAGACCAGAGCAGG - Exonic
934638995 2:96015090-96015112 GGCTCTGTAGAGACCAGAGCAGG - Intergenic
934794653 2:97090322-97090344 GGCTCTGTAGAGACCAGAGCAGG + Exonic
936344241 2:111663033-111663055 GGCTCTCTAGGTGCCAGAGCTGG - Intergenic
936611049 2:114002279-114002301 GGCTCTGAAGAGGCCAGAAATGG - Intergenic
938087377 2:128410291-128410313 GGTTCCCTAGAAACCAGAGCCGG + Intergenic
938502018 2:131835346-131835368 GGCCCTGCAGAGACCATATCTGG + Intergenic
941166883 2:162092149-162092171 GGCTAAGCAGAGACCAGAACAGG - Intergenic
943425767 2:187731767-187731789 GAATTTGTAGAGGCCAGAGCAGG + Intergenic
943547758 2:189302371-189302393 GGGTCTGTAGAGTACGGAGCTGG - Intergenic
946146879 2:217737791-217737813 GACTCTGCAGATACCTGAGCTGG - Intronic
947362791 2:229363468-229363490 GGCTGTGTAGAGGCCATGGCTGG - Intronic
947745653 2:232506180-232506202 GGCTGTGAAGAGCCCAGAGAGGG + Intergenic
1170320760 20:15095373-15095395 GGCTCATTAGAGACCACAGCAGG - Intronic
1171003201 20:21435747-21435769 GTCTCCGGAGAGAGCAGAGCAGG + Intergenic
1173769934 20:45647652-45647674 GTCTCAGTAGACTCCAGAGCTGG - Intergenic
1174051215 20:47768799-47768821 TGCTCTGAAGAGAGCAGTGCTGG - Intronic
1174133091 20:48359694-48359716 GTCTCAGCAGAGCCCAGAGCTGG + Intergenic
1174732894 20:52935514-52935536 GGGTCCGTGGAGCCCAGAGCTGG - Intergenic
1176170598 20:63694767-63694789 GGGTCTGGAGTGCCCAGAGCAGG + Exonic
1178122243 21:29481066-29481088 GGCTCTGTAGAGTGAAGAGAAGG + Intronic
1178620166 21:34167293-34167315 GGCTTTGGAGACACAAGAGCTGG - Intergenic
1179086823 21:38225723-38225745 GCTTCTGGAGTGACCAGAGCAGG + Intronic
1179390867 21:40990189-40990211 GACCCAGTAGAGCCCAGAGCTGG - Intergenic
1180706877 22:17815641-17815663 GGCTCTGTAGAGGGTGGAGCAGG + Intronic
1180921154 22:19522355-19522377 GGCTCTGTAGGGAGCTGCGCTGG + Intergenic
1181065337 22:20303177-20303199 GGCCCTGTAGAGATGAGAGGGGG - Intergenic
1181274988 22:21682574-21682596 GGCCCTGTAGAGGCCTGGGCTGG - Intronic
1181876061 22:25941765-25941787 GGATCTGGATAGACCAGACCAGG - Intronic
1183456805 22:37927324-37927346 GGCTCTGTTGAGAGTGGAGCCGG + Intronic
1183718775 22:39550090-39550112 CCGTTTGTAGAGACCAGAGCTGG - Intergenic
1185316356 22:50180898-50180920 GGCTCGGCTGAGATCAGAGCGGG + Intergenic
950717930 3:14862874-14862896 GGCTCTGCCAAGGCCAGAGCAGG - Intronic
951204361 3:19910027-19910049 TGCTCTGTAGCTACCACAGCTGG - Intronic
952702252 3:36339791-36339813 GGCACTGTGAAGACCAGAGGAGG - Intergenic
953290241 3:41653205-41653227 GGCTCTGGAGTGATCAGGGCAGG - Intronic
953906606 3:46871609-46871631 GGCTGTGGGGAGACCACAGCAGG + Intronic
953983892 3:47426888-47426910 GGCTCAAGAGAGACCAGAGGAGG + Intronic
954025892 3:47782452-47782474 GGCTCTTTCGAGACCTCAGCAGG + Intergenic
954215117 3:49120417-49120439 GGCTGTTTAGAGACCCGAGCCGG + Intronic
954452903 3:50581237-50581259 GAGTCTGCACAGACCAGAGCTGG - Exonic
954491720 3:50913024-50913046 TGCCCTGTAGCAACCAGAGCTGG + Intronic
954493942 3:50935071-50935093 GCCTCTCTAGAGACCAGGTCAGG - Intronic
954874331 3:53791583-53791605 GTCTCTGCAGAGAGCAGGGCCGG - Intronic
955190894 3:56760668-56760690 GGCTCTGTTGGAACCAGATCTGG - Intronic
956485003 3:69712717-69712739 GGCTCTGTAGAGATGATATCAGG - Intergenic
960634890 3:119774945-119774967 GGTTCTGGAGGGAGCAGAGCAGG + Intergenic
960742150 3:120846216-120846238 AGCTCTGGAGTGAGCAGAGCTGG + Intergenic
961033991 3:123629623-123629645 GACTCTGGAGAGACAAGAGCAGG + Exonic
962423593 3:135249599-135249621 GTCTCTGTATAGACCAGGCCTGG + Intronic
963369561 3:144381287-144381309 GTGTCTGTAGAGAAGAGAGCAGG - Intergenic
963448044 3:145440070-145440092 TGCTCTGTAGCCACCACAGCTGG - Intergenic
968462827 4:733832-733854 GGTTCTGAAGAGCACAGAGCTGG - Intronic
968719835 4:2193606-2193628 GGCTCTAAAGAGCCCAGAGTAGG - Intronic
968911670 4:3479613-3479635 AGCTCTGCAGAGAGCAGAGAGGG + Intronic
969115853 4:4870376-4870398 GGCGCTGCGGAGAGCAGAGCCGG - Intergenic
969320922 4:6412053-6412075 GGGTCTGTGGGGCCCAGAGCTGG - Intronic
969443032 4:7228461-7228483 GGCTCAGTAGAGACTGGAGAGGG - Intronic
969518606 4:7662459-7662481 GGCCCTGGAGAGTGCAGAGCTGG - Intronic
969619244 4:8270619-8270641 AGTTCTGAAGAGACCAGAGCTGG - Intronic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
971089471 4:23324110-23324132 GTCTCTGCAAAGGCCAGAGCTGG - Intergenic
972835197 4:42862153-42862175 GGCACTGTAGAGACTAAAGTAGG + Intergenic
975366403 4:73534231-73534253 TGCTTTGTAGAGTCCAGAGGTGG + Intergenic
977257275 4:94755100-94755122 GGATCTTTAGAGATCAAAGCGGG - Intergenic
977611847 4:99043703-99043725 GGTTTTGAAGAGACCAGGGCAGG + Intronic
979621571 4:122804402-122804424 CTCTCTGCAGAGACCAGAGGTGG + Intergenic
981119006 4:141026905-141026927 AGCTCTGAAGATACCTGAGCAGG + Intronic
981964961 4:150589351-150589373 TGCTCTGCGGAGATCAGAGCAGG + Intronic
982043935 4:151422854-151422876 GATTGTGTAGAGATCAGAGCTGG + Intronic
983638851 4:169925480-169925502 AGCTCTCTAGAGGACAGAGCAGG + Intergenic
984612491 4:181856780-181856802 TGCTCTGTACACACCAGAGGAGG + Intergenic
986045442 5:4032516-4032538 GGCTCTGTGAGGACAAGAGCTGG + Intergenic
988143639 5:27275521-27275543 GTTTCTGCAGAGAACAGAGCAGG + Intergenic
994132336 5:96244683-96244705 GGCTTTGTAGTGAGCAGAACTGG - Intergenic
995203338 5:109450738-109450760 AGCCCTGTAAAGACCAGGGCGGG + Intergenic
995850246 5:116537431-116537453 GGGTCTGTGGAGACCAGGTCAGG + Intronic
996102580 5:119459655-119459677 GACTCTGTAGAGTCCCGAGATGG + Intronic
998716393 5:144889500-144889522 TGCCCTGTAGCCACCAGAGCTGG - Intergenic
999134596 5:149310096-149310118 GGCACTGCAGAGCCGAGAGCAGG + Exonic
1001658471 5:173372565-173372587 GGCTTTGTGGTGACCACAGCTGG + Intergenic
1005442092 6:25881185-25881207 GACTCTGCAGAGTCCAGATCTGG - Intronic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1006162972 6:32048647-32048669 GGCGCTGAAAAGAGCAGAGCAGG + Intronic
1006436549 6:34028761-34028783 GGCTCTCAGGAGACCACAGCTGG + Intronic
1007623670 6:43229893-43229915 GGCTGTGGAGAGCCCAGAGGAGG - Intergenic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1011557241 6:88583957-88583979 GGCTCTGTAGTGCCCAGAATAGG + Intergenic
1019170901 6:170132638-170132660 GGCTCTGTAGGCAACAGGGCTGG + Intergenic
1019304098 7:324353-324375 GGCTCAGGAGAGGGCAGAGCTGG - Intergenic
1019394803 7:812099-812121 GGTTCTGGAGAGAACAGAGGAGG - Intergenic
1027263963 7:76483727-76483749 GGCCCAGTGCAGACCAGAGCGGG + Intronic
1027267155 7:76500747-76500769 GGCTATGGAGAGGCCAGGGCCGG - Intronic
1027315333 7:76981840-76981862 GGCCCAGTGCAGACCAGAGCGGG + Intergenic
1027318967 7:77000615-77000637 GGCTATGGAGAGGCCAGGGCCGG - Intergenic
1031226125 7:119040468-119040490 GACTCTGCAGAGTCCAGAGGTGG - Intergenic
1035993893 8:4523872-4523894 GGCTTTGTAAAGACCAAAGAAGG - Intronic
1037470950 8:19210265-19210287 GGCACTGTGGAGACTAGGGCAGG + Intergenic
1037861038 8:22405756-22405778 GTCCCTGCAGAGACCAGGGCTGG + Intronic
1037921603 8:22810228-22810250 GGTTCTGTAGAAACCACATCAGG - Intronic
1038674499 8:29611384-29611406 GGATGTGGAGAGAACAGAGCTGG - Intergenic
1040459139 8:47630383-47630405 AAACCTGTAGAGACCAGAGCTGG - Intronic
1040963800 8:53064142-53064164 GGATCTGCAGGGACCAGAGGTGG - Intergenic
1042251006 8:66756202-66756224 GGCTCAGGAGAGACCAGCTCTGG + Intronic
1043667306 8:82832058-82832080 GGCTCAGAAAAGACCAGAGAAGG - Intergenic
1048194950 8:132324808-132324830 GGCTCTGGAGCCAGCAGAGCTGG - Intronic
1048208070 8:132431444-132431466 ACCTCCCTAGAGACCAGAGCTGG - Intronic
1053006287 9:34606964-34606986 GGCCCCGTAGAGACCAAAGATGG + Intergenic
1055478784 9:76689548-76689570 GTCTCTATAGAGACCAGCTCAGG + Intronic
1058418040 9:104808287-104808309 GGCTCTGTAGGAGCCAGAACTGG - Intronic
1060925557 9:127452857-127452879 GTGTCTGTAAATACCAGAGCTGG - Intronic
1061090200 9:128421718-128421740 TGGTCTGTAGACACCAGAACAGG + Intronic
1062035896 9:134382400-134382422 GGTGCTGAGGAGACCAGAGCTGG + Intronic
1062173048 9:135145882-135145904 TGCTGTGTAGAGAACTGAGCAGG - Intergenic
1062497428 9:136838333-136838355 GGCCCTGTGGAGACCACATCTGG - Intronic
1062702852 9:137917146-137917168 GGCTCTGGAGAGCTCACAGCAGG - Intronic
1186894318 X:13990760-13990782 GGGTCTCTGGAGTCCAGAGCTGG + Intergenic
1187944340 X:24411869-24411891 GGGTCTGGAGAGGCAAGAGCTGG - Intergenic
1188040558 X:25366467-25366489 GGCCCTGTAGCCACCACAGCTGG + Intergenic
1189124609 X:38433171-38433193 GCCTCTTCAGAGACCAGAGAAGG - Intronic
1189242189 X:39533865-39533887 GGATCTGTTGAGAATAGAGCAGG - Intergenic
1189710614 X:43807980-43808002 GGATCTGCAGAGACCATAGTGGG - Intronic
1190755085 X:53394660-53394682 GGCTCTGTGAAGACCATGGCTGG - Intronic
1191694605 X:63977246-63977268 TGCCCTGTAGCCACCAGAGCTGG - Intergenic
1191984095 X:66959898-66959920 TGCTCTGTAGTCATCAGAGCTGG + Intergenic
1192229580 X:69255904-69255926 GGCTCTGAAGAGCCCTGAGGGGG - Intergenic
1196791501 X:119468738-119468760 GGCTTAGGAGAGGCCAGAGCGGG + Intronic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1198690709 X:139281439-139281461 GACTATGTAGAGAGCAGAGTGGG - Intergenic
1200006162 X:153085835-153085857 GTCTCTGTACAGGCCTGAGCAGG - Intergenic