ID: 934794691

View in Genome Browser
Species Human (GRCh38)
Location 2:97090594-97090616
Sequence CGGGGTAACCAGAAGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 2, 2: 0, 3: 14, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934794691_934794702 7 Left 934794691 2:97090594-97090616 CCTTTCCCCTTCTGGTTACCCCG 0: 1
1: 2
2: 0
3: 14
4: 175
Right 934794702 2:97090624-97090646 GGCTCTTCGCAGCTACTCTATGG 0: 3
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934794691 Original CRISPR CGGGGTAACCAGAAGGGGAA AGG (reversed) Intronic
900249388 1:1659417-1659439 CGAGGTAACCAGCAGGTAAATGG - Intronic
900260327 1:1724728-1724750 CGAGGTAACCAGCAGGTAAATGG - Intergenic
900803787 1:4754418-4754440 GTGGGTAGCCAGAAGGGAAAGGG - Intronic
902994887 1:20216632-20216654 CGGGGTCCCCAGATGGGGCAGGG + Intergenic
904923347 1:34026294-34026316 CTTGGTAACCATAAGGGGAAAGG - Intronic
905558707 1:38908948-38908970 TGGGGTAGCCAGAAGGCGGATGG + Intronic
911601274 1:99850316-99850338 GGGGAGAAACAGAAGGGGAAGGG - Intronic
916791472 1:168129131-168129153 CAGGGTAAGCAGAGAGGGAATGG + Intronic
918653169 1:186991155-186991177 GGAGGTAAAGAGAAGGGGAAAGG - Intergenic
921116158 1:212093500-212093522 TGGGGGAGCCAGAAGGGAAATGG + Intronic
921261647 1:213389671-213389693 CTGGGTAAAAAGAAAGGGAAGGG - Intergenic
923252676 1:232191852-232191874 AGGGGAAGCCAGAAGGGGGATGG - Intergenic
923849360 1:237776664-237776686 GGGGTTAATCAGGAGGGGAAAGG - Intronic
924384641 1:243489838-243489860 CGGGGCCACCAGCAGGGAAAAGG + Intronic
924697796 1:246418664-246418686 TGGGGGAGCCAGAAGGGAAATGG + Intronic
1063357747 10:5417052-5417074 TGGGGGAGCCAGAAGGGAAATGG + Intronic
1064125781 10:12658790-12658812 AGGGGAGGCCAGAAGGGGAATGG - Intronic
1067272650 10:44805426-44805448 CTGGGGATCCAGCAGGGGAAAGG + Intergenic
1067435282 10:46272591-46272613 CGGGTGACCCAGAAGGGGAGTGG - Intergenic
1068064776 10:52115761-52115783 CTGGGTATACAGAAGGGTAAAGG - Intronic
1073330537 10:102667612-102667634 AGGGGATACCAGAAGGGGAGGGG + Intergenic
1074455970 10:113595317-113595339 CTGGGTAACCATGAGGGGAGTGG - Intronic
1074555314 10:114483984-114484006 CGGGGCATCCTGCAGGGGAAGGG - Intronic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1076648579 10:131971426-131971448 CGGGATAAGCAGGAGGGAAAAGG + Intronic
1077147567 11:1052860-1052882 CCGGGGAAGCAGAAGGGAAAGGG - Intergenic
1077695967 11:4393330-4393352 GGAGTTACCCAGAAGGGGAAGGG - Intronic
1077695991 11:4393402-4393424 CGAGTTACCCAGAAGGGGAAGGG - Intronic
1078384114 11:10872763-10872785 AGGGGTAAGGGGAAGGGGAAGGG - Intergenic
1081340489 11:41921519-41921541 CTGGGTCTCCAGAAAGGGAAAGG - Intergenic
1082196804 11:49316264-49316286 AGGGGTAAGGGGAAGGGGAAGGG + Intergenic
1083741655 11:64714458-64714480 CAGGGTAACCAGACTGGGAAGGG + Intronic
1091130047 11:133138397-133138419 CAAGGTAACCATATGGGGAAAGG + Intronic
1091348825 11:134876436-134876458 CTTGGAAACCAGAACGGGAAAGG + Intergenic
1094249288 12:28340964-28340986 TGGGGTAGCCAGAAGGGAGATGG + Intronic
1094491644 12:30964353-30964375 CGGGATAAGGAGGAGGGGAAGGG - Intronic
1094636036 12:32227663-32227685 TGGGGTAGCCAGGAGGGCAAAGG + Intronic
1096868797 12:54580450-54580472 TGGGATGGCCAGAAGGGGAAGGG - Intronic
1099499135 12:83389514-83389536 TGGGGGAGCCAGAAGGGAAATGG - Intergenic
1103360973 12:120353371-120353393 CTGGGTAACCTGATGGGGCAAGG + Exonic
1103549885 12:121729130-121729152 GATGTTAACCAGAAGGGGAATGG + Intronic
1104492826 12:129209382-129209404 CAGGATAACCAGAATGGGATGGG + Intronic
1106182961 13:27383879-27383901 CGGGGGAGCCAGAAGGGAGATGG - Intergenic
1106438918 13:29748282-29748304 TGGGGCAAGCAGAAGGGCAAAGG - Intergenic
1110964515 13:81676151-81676173 TGGGGAAGCCAGAAGGGGGATGG + Intergenic
1111343934 13:86924524-86924546 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1112506509 13:99979555-99979577 CGAGGTAACTAGAGAGGGAACGG - Intergenic
1112794548 13:103041933-103041955 CAAGGTAACCAGAAGTGAAAGGG - Intergenic
1113389476 13:109881730-109881752 TGGTTTAACCAGAACGGGAACGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118667445 14:68086154-68086176 GGGGGAAGCCAGAAGGGGAATGG + Intronic
1118761465 14:68882661-68882683 TGGAGGACCCAGAAGGGGAAGGG + Intronic
1122266325 14:100548598-100548620 CAGGGTGCCCAGAAGGGGCAGGG - Intronic
1128352630 15:66901240-66901262 CTGGGGAACCAGAAGAGGCAGGG + Intergenic
1128894191 15:71357582-71357604 CGGGAGAGCCAGGAGGGGAAAGG - Intronic
1129323163 15:74785935-74785957 CTGGGAGACCGGAAGGGGAATGG - Intronic
1129686666 15:77689870-77689892 GGGGGAAGCAAGAAGGGGAAGGG + Intronic
1131431245 15:92390967-92390989 AGGGGTAAGCAGGAGGGGAGGGG + Intergenic
1134588637 16:15434474-15434496 ACGGGTACCCAGAAGGGGCAGGG - Exonic
1135991613 16:27222025-27222047 TGGGGTAACTAGAAGGGGGATGG + Intergenic
1135992392 16:27225908-27225930 CGGGGAAGCCACAAGGGAAATGG + Intronic
1136398743 16:30006577-30006599 CGAGGTACCCAGGAGGGGACGGG - Exonic
1136608247 16:31350970-31350992 TGGGGTCTCCAGAAGGGGAGAGG + Intergenic
1138882410 16:61031607-61031629 CCTGGTAGCCACAAGGGGAATGG - Intergenic
1140869866 16:79096464-79096486 TGGGATAACCAGGAGGGGCATGG - Intronic
1143465534 17:7133956-7133978 TGGGGTGGCCAGAAGGGGGATGG + Intergenic
1143496930 17:7317744-7317766 GGGGGAAAACAGTAGGGGAAAGG + Intronic
1143836499 17:9696879-9696901 CAGGGGAACCAGAGGGGAAAGGG - Intronic
1144244068 17:13345871-13345893 CAGGGTGAAGAGAAGGGGAATGG + Intergenic
1144438269 17:15260591-15260613 CTGGGAACCCAGATGGGGAAGGG + Intronic
1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG + Intronic
1147533092 17:41298589-41298611 CGGGGGAGCCAGAAGGGGGATGG - Intergenic
1148084506 17:44985807-44985829 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1151359929 17:73582721-73582743 GGGGGTACCCAGGAGGAGAAGGG - Intronic
1152643225 17:81457769-81457791 CTGGGTAATCAGGAGGGGGAGGG + Intronic
1152643250 17:81457830-81457852 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152643321 17:81458010-81458032 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1155071984 18:22324861-22324883 CGAGGGACCCAAAAGGGGAATGG + Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1159451816 18:68612113-68612135 GGGGGCTACTAGAAGGGGAAAGG + Intergenic
1161208233 19:3053379-3053401 CGGGGTGCCCAGGACGGGAAAGG + Exonic
1165295830 19:34925372-34925394 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1165301962 19:34975846-34975868 TGGGGACCCCAGAAGGGGAAGGG - Intergenic
1167414583 19:49363351-49363373 CGGGAAAACCAGAAGGGACACGG + Intronic
927937746 2:27085085-27085107 CTGGGGATCCAGCAGGGGAAGGG + Intronic
928418929 2:31122225-31122247 CGGGATAAGCAGAACGTGAAGGG + Intronic
928537921 2:32258103-32258125 TGGGGTAGCCAGAAGGGAGATGG + Intronic
929628516 2:43434683-43434705 TGGGGGAACCAGAAGGGAGATGG - Intronic
934576739 2:95406650-95406672 CGGGGTAACCGGAAGGGGAAAGG + Intronic
934638958 2:96014818-96014840 CGGGGTAACCGGAAGGGGAAAGG + Intergenic
934794691 2:97090594-97090616 CGGGGTAACCAGAAGGGGAAAGG - Intronic
936674528 2:114699787-114699809 CAGAGGAACCAGAAGGGGCAAGG + Intronic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
937820760 2:126308084-126308106 CGGGGGAGCCAGAAGGGAGATGG + Intergenic
938108277 2:128547860-128547882 CCTGGGAAGCAGAAGGGGAAAGG + Intergenic
938407188 2:131039207-131039229 AGGGCTCACCAGAAGAGGAATGG - Intronic
938799178 2:134744953-134744975 GGGGGTAATTAGTAGGGGAATGG + Intergenic
940034841 2:149302500-149302522 CGGTGTACCCAGAAAGGTAATGG + Intergenic
941125202 2:161576317-161576339 TGGGGAGGCCAGAAGGGGAATGG - Intronic
944728355 2:202495285-202495307 TGGGGGAACCAGAAGGGAGATGG + Intronic
945986073 2:216354644-216354666 CAGGGGAACCAGAAAGGAAATGG + Intronic
946116758 2:217469534-217469556 CTTGGCACCCAGAAGGGGAAAGG + Intronic
946177989 2:217933556-217933578 CCAGGAAGCCAGAAGGGGAAAGG + Intronic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1173522404 20:43709784-43709806 CGGGGGAAACAGAAGGGAGAGGG - Intronic
1175126341 20:56754815-56754837 GGGGGTAGGGAGAAGGGGAAGGG - Intergenic
1177853588 21:26377213-26377235 CGGGGGAACAAAAAGGTGAAGGG + Intergenic
1179526146 21:41977160-41977182 CTGTGTAACCAGAACAGGAATGG + Intergenic
1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG + Intronic
1183068055 22:35377286-35377308 TGGGGGACCCAGCAGGGGAAAGG - Intergenic
951549390 3:23861797-23861819 TGGGGCAGCCAGAAGGGAAATGG - Intronic
956177130 3:66483648-66483670 CAGAATAACCACAAGGGGAAGGG + Intronic
957479235 3:80770132-80770154 TGGGGAGATCAGAAGGGGAATGG + Intergenic
958663712 3:97106515-97106537 TGGGGAAGCCAGAAGGGGGATGG - Intronic
960980769 3:123223278-123223300 TGGGGTAAAAAGCAGGGGAATGG - Intronic
963280915 3:143384122-143384144 AGGAGGAACAAGAAGGGGAAGGG + Intronic
965969131 3:174532174-174532196 TGGGGGAAGGAGAAGGGGAAGGG + Intronic
966921265 3:184613145-184613167 CCGGGCAACCAGAATGGGGAGGG + Intronic
968048189 3:195635520-195635542 CGGGGGACCCGGAAGGGGATGGG - Intergenic
968099215 3:195954100-195954122 CGGGGGACCCGGAAGGGGATGGG + Intergenic
968306422 3:197654401-197654423 CGGGGGACCCGGAAGGGGATGGG + Intergenic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
969234222 4:5853938-5853960 CTGGGTCACCAGCAGGCGAATGG - Intronic
972573472 4:40330998-40331020 CAGGGTGAGCAGCAGGGGAATGG - Intergenic
973057446 4:45678812-45678834 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
973104396 4:46315825-46315847 AGGGATAAACAGAAGAGGAAGGG - Intronic
976788038 4:88844877-88844899 AGGGGTAAGGAGTAGGGGAAGGG + Intronic
980485439 4:133451134-133451156 TGGGGGAACCAGAAAGGAAATGG - Intergenic
980717067 4:136640277-136640299 GGGGGAAACCAAAAGGGGGATGG - Intergenic
984261249 4:177445337-177445359 CGGGGGAACCAGAAGGGAGACGG - Intergenic
984520533 4:180796374-180796396 ATGGGTAACTAGAAGGGGGATGG + Intergenic
985030414 4:185783650-185783672 CGGGGTAAGCAGAAGTAGACTGG + Intronic
986946660 5:13029276-13029298 AGGGGGAAGAAGAAGGGGAAGGG + Intergenic
990892640 5:60664976-60664998 CGGGGTCATCAGAAAGGAAAGGG + Intronic
992349663 5:75916223-75916245 AGGAGGAACCAGAAGGGGAAGGG - Intergenic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
998920166 5:147059455-147059477 CAGGGTCACCAGGAGAGGAATGG + Intronic
1001731096 5:173959303-173959325 CGCAGGGACCAGAAGGGGAAAGG - Exonic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1002475712 5:179464583-179464605 ATGGGGAGCCAGAAGGGGAATGG + Intergenic
1002636935 5:180613189-180613211 CGGGGTGACTTGATGGGGAAGGG - Intronic
1003135742 6:3433565-3433587 AGGGGTAGCCAGGAGTGGAAAGG + Intronic
1005794758 6:29347960-29347982 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1007040684 6:38719387-38719409 TGGGGGTACAAGAAGGGGAAGGG - Intronic
1007070577 6:39035115-39035137 CATGGTAACCAGAAGGAGCATGG + Intergenic
1010524968 6:76889778-76889800 CGTTGTAAGCATAAGGGGAAAGG - Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1011277271 6:85643213-85643235 CGTGCGAGCCAGAAGGGGAAAGG - Exonic
1011308188 6:85952511-85952533 CGGGAGACACAGAAGGGGAAGGG - Intergenic
1011714873 6:90094785-90094807 CAGGGGAACCAGAAGTGGCATGG - Intronic
1013289699 6:108709312-108709334 AGGGGTAACCAGTAAGGGAGTGG - Intergenic
1013616873 6:111851470-111851492 AGAGGCAACCAAAAGGGGAAGGG + Intronic
1014247246 6:119081682-119081704 TGGGGTAGCCAGAAGGGAGATGG + Intronic
1016769703 6:147835590-147835612 CGGGGTAAACAGAAATGGCATGG - Intergenic
1019983988 7:4641960-4641982 AGGGGTAACCCTAAGGGGAGTGG + Intergenic
1021989941 7:26131413-26131435 TGAGGGAAACAGAAGGGGAATGG + Intergenic
1022921791 7:35023209-35023231 TGGGGTAACTGGGAGGGGAAGGG - Intronic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1026863793 7:73810643-73810665 CGGGGGAACTGGGAGGGGAAGGG - Intronic
1029449385 7:100632410-100632432 GGGGGAAATCAGATGGGGAAGGG - Intronic
1030639615 7:111989216-111989238 TGGGGTAACCAAAAAGGAAAGGG + Intronic
1030746563 7:113173039-113173061 TGGGGAAGCCAGAAGGGGAATGG - Intergenic
1030922154 7:115404489-115404511 CGGGATTACTAGAAGGGGAGGGG + Intergenic
1033804327 7:144937422-144937444 AAGGGTAAGGAGAAGGGGAAGGG - Intergenic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1037820824 8:22133780-22133802 GGGGGTAACCTGGAGGGGAGGGG - Intergenic
1039086315 8:33783604-33783626 TGGGGGAGCCAGAAGGGGGATGG + Intergenic
1041011445 8:53547598-53547620 GAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1042103391 8:65297992-65298014 TGGGGTAACAACATGGGGAAAGG + Intergenic
1045881525 8:107045965-107045987 AGGGGAAAGCAGAGGGGGAAGGG + Intergenic
1046138915 8:110064051-110064073 TGGGGGAGCCAGAAGGGAAATGG - Intergenic
1046541595 8:115590514-115590536 CAGGGTGACAAGAAGGAGAAGGG + Intronic
1047203695 8:122786700-122786722 GGGGGGAGGCAGAAGGGGAATGG - Intronic
1048963263 8:139597234-139597256 CGGGGTAAAGAGAAAAGGAAGGG - Intergenic
1049204911 8:141359190-141359212 AGGGGCCACCAGGAGGGGAAGGG - Intronic
1049214801 8:141402657-141402679 AGGGGTAGCCAGAGGCGGAAGGG - Intronic
1050633375 9:7583585-7583607 AGGGGTAAACAGCAGGGGAAGGG + Intergenic
1057817184 9:98304291-98304313 TGGGGTAAATGGAAGGGGAAGGG + Intronic
1058584468 9:106492243-106492265 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1059977990 9:119738273-119738295 TGTGGTAAGGAGAAGGGGAATGG - Intergenic
1060209047 9:121699295-121699317 CGGGGGGACAAGAGGGGGAAGGG - Intronic
1061222411 9:129259892-129259914 GCGGGTAACCAGAAAGGGAGTGG - Intergenic
1187843801 X:23515468-23515490 AGGGGAAAGCGGAAGGGGAAGGG - Intergenic
1189700957 X:43716031-43716053 GGGGGTGACCTGAAGGGTAAAGG + Intronic
1192207598 X:69106541-69106563 AGGTGTAACCTGGAGGGGAAGGG - Intergenic
1195367292 X:104138711-104138733 CGGGGGAACCAGAAGGGAGATGG + Intronic
1196072302 X:111539336-111539358 TGGGGGAACCAGAAGGGAGATGG - Intergenic
1196242066 X:113353424-113353446 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1196271419 X:113716342-113716364 ATGGGGAACCGGAAGGGGAATGG - Intergenic
1196815912 X:119665511-119665533 TAGGGAAACCAGTAGGGGAAAGG + Intronic
1197248920 X:124194292-124194314 TGGGGTAACCACAGGAGGAATGG - Intronic
1199142628 X:144331436-144331458 CGGGGGAGCCAGAAGGGAGATGG + Intergenic