ID: 934795500

View in Genome Browser
Species Human (GRCh38)
Location 2:97095641-97095663
Sequence CTCAAATAGAAGTCGGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 2, 1: 1, 2: 0, 3: 4, 4: 63}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934795500_934795512 22 Left 934795500 2:97095641-97095663 CCATGGCCCGACTTCTATTTGAG 0: 2
1: 1
2: 0
3: 4
4: 63
Right 934795512 2:97095686-97095708 CTAAGGAAAGGTATCTGGGTGGG 0: 2
1: 0
2: 3
3: 16
4: 206
934795500_934795505 10 Left 934795500 2:97095641-97095663 CCATGGCCCGACTTCTATTTGAG 0: 2
1: 1
2: 0
3: 4
4: 63
Right 934795505 2:97095674-97095696 CTGGCCACCCGTCTAAGGAAAGG 0: 1
1: 2
2: 0
3: 5
4: 67
934795500_934795503 -9 Left 934795500 2:97095641-97095663 CCATGGCCCGACTTCTATTTGAG 0: 2
1: 1
2: 0
3: 4
4: 63
Right 934795503 2:97095655-97095677 CTATTTGAGAAGTTTTTCTCTGG 0: 3
1: 1
2: 1
3: 31
4: 271
934795500_934795504 5 Left 934795500 2:97095641-97095663 CCATGGCCCGACTTCTATTTGAG 0: 2
1: 1
2: 0
3: 4
4: 63
Right 934795504 2:97095669-97095691 TTTCTCTGGCCACCCGTCTAAGG 0: 1
1: 2
2: 2
3: 8
4: 87
934795500_934795513 25 Left 934795500 2:97095641-97095663 CCATGGCCCGACTTCTATTTGAG 0: 2
1: 1
2: 0
3: 4
4: 63
Right 934795513 2:97095689-97095711 AGGAAAGGTATCTGGGTGGGTGG 0: 2
1: 1
2: 1
3: 42
4: 486
934795500_934795514 30 Left 934795500 2:97095641-97095663 CCATGGCCCGACTTCTATTTGAG 0: 2
1: 1
2: 0
3: 4
4: 63
Right 934795514 2:97095694-97095716 AGGTATCTGGGTGGGTGGTGCGG 0: 2
1: 1
2: 8
3: 55
4: 554
934795500_934795508 17 Left 934795500 2:97095641-97095663 CCATGGCCCGACTTCTATTTGAG 0: 2
1: 1
2: 0
3: 4
4: 63
Right 934795508 2:97095681-97095703 CCCGTCTAAGGAAAGGTATCTGG 0: 1
1: 1
2: 1
3: 2
4: 40
934795500_934795511 21 Left 934795500 2:97095641-97095663 CCATGGCCCGACTTCTATTTGAG 0: 2
1: 1
2: 0
3: 4
4: 63
Right 934795511 2:97095685-97095707 TCTAAGGAAAGGTATCTGGGTGG 0: 2
1: 0
2: 3
3: 16
4: 154
934795500_934795510 18 Left 934795500 2:97095641-97095663 CCATGGCCCGACTTCTATTTGAG 0: 2
1: 1
2: 0
3: 4
4: 63
Right 934795510 2:97095682-97095704 CCGTCTAAGGAAAGGTATCTGGG 0: 1
1: 1
2: 1
3: 5
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934795500 Original CRISPR CTCAAATAGAAGTCGGGCCA TGG (reversed) Intergenic
907845764 1:58205184-58205206 CTCAGATGGAAGTCTGTCCATGG - Intronic
908306082 1:62818285-62818307 TTAAAATAGAAGTCTGACCATGG - Intronic
913332430 1:117678617-117678639 CTCAAGAAGAAGTGGTGCCAGGG - Intergenic
915406024 1:155660298-155660320 CTCAAAAAGAAGGGGAGCCAGGG - Exonic
920373061 1:205491903-205491925 CTCAGAAAGGAGTCAGGCCACGG - Intergenic
923445477 1:234066658-234066680 CTCAAATAGAAGTTGGACGAGGG + Intronic
924385174 1:243493127-243493149 CTCAAACAAAAGACAGGCCAGGG - Intronic
1067773847 10:49147070-49147092 CTCAAAAAGAAGTTGAGCCTGGG - Intergenic
1071213068 10:83366735-83366757 CTCTAATAGAAGTCTGGGGATGG - Intergenic
1079490301 11:20981655-20981677 GACAAATAGAAATAGGGCCAAGG - Intronic
1079798931 11:24844761-24844783 CCAACATAGAACTCGGGCCATGG + Intronic
1085472891 11:76769376-76769398 CTCAAATCTCAGCCGGGCCAGGG - Intergenic
1096257627 12:50072880-50072902 CTGAAATAGAGCTGGGGCCAGGG + Intronic
1104003033 12:124872583-124872605 CTCAAAAAAAAGTAAGGCCAGGG - Intronic
1106075762 13:26459559-26459581 CTCAAAGACAAGCTGGGCCAGGG + Intergenic
1108713222 13:53054612-53054634 CTCAAACAGATGTCATGCCATGG + Intergenic
1112919779 13:104597874-104597896 CTCAGAAAGAAGGAGGGCCAGGG - Intergenic
1113780099 13:112971791-112971813 ATCACATAGAAGGGGGGCCAGGG - Intronic
1119753104 14:77094700-77094722 TTCAAATAAAACTCGGCCCATGG + Intergenic
1122023029 14:98854831-98854853 CCCAAAAAGAAGTCGGGGCTGGG + Intergenic
1131743660 15:95421487-95421509 CCAAAATAGAGCTCGGGCCATGG - Intergenic
1133471781 16:6082735-6082757 CTCAAATAGAACTAGGGCTGAGG + Intronic
1133901142 16:9976239-9976261 CTCACATAGTAGTCATGCCATGG - Intronic
1140250177 16:73288267-73288289 CTCAAATAAAAATCCGGCCAGGG + Intergenic
1141478754 16:84292304-84292326 CTCAAATGGAACCTGGGCCAAGG + Intergenic
1145070459 17:19801276-19801298 CTCAAAAAGAAGTTGGGGCCGGG + Intronic
1158524301 18:58198437-58198459 CTAAAACAAAATTCGGGCCAGGG - Intronic
1162970806 19:14180249-14180271 AACAAATAGAAGTCAGGCAAGGG - Intronic
1164705851 19:30319115-30319137 TTAAAATAGAAGTCCGGGCATGG + Intronic
925864772 2:8217827-8217849 TTAAAATAGAAGTGGGGGCAGGG - Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
937583333 2:123515715-123515737 CTCAAATAAAAGTGTTGCCAGGG - Intergenic
939588934 2:144039686-144039708 CTCAAACAGAAGTCAGGAAAAGG - Intronic
948781459 2:240324230-240324252 CTCAAACAGCAGTGGGGCCCGGG + Intergenic
1175629271 20:60519539-60519561 CCCAAATATCAGTCGCGCCACGG + Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176661992 21:9645699-9645721 CTCAAAAATTAGTTGGGCCATGG - Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1182011305 22:27002946-27002968 CTGAAATGGAAGTAGGGGCAAGG - Intergenic
1184205685 22:43001038-43001060 CTCAAATAAAACTTAGGCCAAGG + Intronic
950422766 3:12908447-12908469 CTCAAAAAGGAGTCGGGCAACGG - Exonic
953570065 3:44064257-44064279 CTCAACTAGAAGTTGGACTATGG - Intergenic
974060043 4:57024602-57024624 TTCAAATAGAAGTCGATCCATGG - Intronic
985413403 4:189710847-189710869 CTCAAAAATTAGTTGGGCCATGG + Intergenic
987292762 5:16524027-16524049 CTCAGATGGAAGGCGGGGCAGGG - Intronic
994520603 5:100829450-100829472 CTAAAATAGAATTCAGGCAAAGG - Intronic
994538929 5:101069729-101069751 TTCAAAAAGATGTAGGGCCAAGG - Intergenic
999889417 5:155960405-155960427 CTCAAACAGAAGACTGGCCTGGG - Intronic
1000005733 5:157182808-157182830 CACAAATAGCAGTTGGGCTAAGG - Intronic
1002105490 5:176877671-176877693 CTCAAAAAGCAGTCGTGCGAGGG + Exonic
1002313621 5:178329510-178329532 CTCAGCCAGAAGTAGGGCCAAGG + Intronic
1002554082 5:180020634-180020656 ATCACATACAAGTAGGGCCAAGG + Intronic
1007017600 6:38484396-38484418 CTCAAATAGTAGTCAGTCCCAGG - Intronic
1008165974 6:48138847-48138869 CTCAAGTAGAAGGCAGACCATGG + Intergenic
1009808488 6:68633130-68633152 TTCAAGTAGAAGTCAGGGCAGGG - Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1031907251 7:127474428-127474450 CTCAAAGAGAAGTAGGGGGAAGG - Intergenic
1032299770 7:130675937-130675959 CTCAACTAGGAGTGGGGACACGG + Intronic
1037062228 8:14528722-14528744 CAGAAATAGAAATTGGGCCAGGG - Intronic
1038257796 8:25966648-25966670 CTCAAAGAGGAGATGGGCCAAGG - Intronic
1038984426 8:32793110-32793132 CTCAAATGGCAGAAGGGCCAAGG + Intergenic
1039805870 8:40997534-40997556 ATTAAATAGAAGTCTGGGCATGG - Intergenic
1041716935 8:60941022-60941044 CTCACATGGAAGAAGGGCCATGG + Intergenic
1042837199 8:73089872-73089894 CTCAAAAAAAAGTAGGGGCAGGG - Intronic
1051145861 9:14026715-14026737 CTCAAATACTAGTTGTGCCATGG + Intergenic
1203639553 Un_KI270750v1:147542-147564 CTCAAAAATTAGTTGGGCCATGG - Intergenic
1192140855 X:68646519-68646541 CTGAAACAGAAGTGAGGCCAGGG + Intergenic
1200017055 X:153173920-153173942 CTCACATGGAAGACGGGGCAAGG - Intergenic