ID: 934796930

View in Genome Browser
Species Human (GRCh38)
Location 2:97109274-97109296
Sequence CTGGTGACTCAAAGAGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934796930_934796931 -5 Left 934796930 2:97109274-97109296 CCTTTCTCTCTTTGAGTCACCAG No data
Right 934796931 2:97109292-97109314 ACCAGTTTCTTTACTGTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934796930 Original CRISPR CTGGTGACTCAAAGAGAGAA AGG (reversed) Intergenic
No off target data available for this crispr