ID: 934796931

View in Genome Browser
Species Human (GRCh38)
Location 2:97109292-97109314
Sequence ACCAGTTTCTTTACTGTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934796929_934796931 10 Left 934796929 2:97109259-97109281 CCAGAATGTTCTTTTCCTTTCTC No data
Right 934796931 2:97109292-97109314 ACCAGTTTCTTTACTGTATTAGG No data
934796927_934796931 26 Left 934796927 2:97109243-97109265 CCCTCTCTATTTTGCTCCAGAAT No data
Right 934796931 2:97109292-97109314 ACCAGTTTCTTTACTGTATTAGG No data
934796930_934796931 -5 Left 934796930 2:97109274-97109296 CCTTTCTCTCTTTGAGTCACCAG No data
Right 934796931 2:97109292-97109314 ACCAGTTTCTTTACTGTATTAGG No data
934796928_934796931 25 Left 934796928 2:97109244-97109266 CCTCTCTATTTTGCTCCAGAATG No data
Right 934796931 2:97109292-97109314 ACCAGTTTCTTTACTGTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934796931 Original CRISPR ACCAGTTTCTTTACTGTATT AGG Intergenic
No off target data available for this crispr