ID: 934797338

View in Genome Browser
Species Human (GRCh38)
Location 2:97113006-97113028
Sequence CAGCCTGGCCGCGGCAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934797327_934797338 2 Left 934797327 2:97112981-97113003 CCTCCAGCCGCGCGGACCCCGGG No data
Right 934797338 2:97113006-97113028 CAGCCTGGCCGCGGCAAGTCAGG No data
934797331_934797338 -5 Left 934797331 2:97112988-97113010 CCGCGCGGACCCCGGGGCCAGCC No data
Right 934797338 2:97113006-97113028 CAGCCTGGCCGCGGCAAGTCAGG No data
934797322_934797338 17 Left 934797322 2:97112966-97112988 CCGACCAGGCCTGCGCCTCCAGC No data
Right 934797338 2:97113006-97113028 CAGCCTGGCCGCGGCAAGTCAGG No data
934797330_934797338 -1 Left 934797330 2:97112984-97113006 CCAGCCGCGCGGACCCCGGGGCC No data
Right 934797338 2:97113006-97113028 CAGCCTGGCCGCGGCAAGTCAGG No data
934797323_934797338 13 Left 934797323 2:97112970-97112992 CCAGGCCTGCGCCTCCAGCCGCG No data
Right 934797338 2:97113006-97113028 CAGCCTGGCCGCGGCAAGTCAGG No data
934797321_934797338 18 Left 934797321 2:97112965-97112987 CCCGACCAGGCCTGCGCCTCCAG No data
Right 934797338 2:97113006-97113028 CAGCCTGGCCGCGGCAAGTCAGG No data
934797320_934797338 19 Left 934797320 2:97112964-97112986 CCCCGACCAGGCCTGCGCCTCCA No data
Right 934797338 2:97113006-97113028 CAGCCTGGCCGCGGCAAGTCAGG No data
934797325_934797338 8 Left 934797325 2:97112975-97112997 CCTGCGCCTCCAGCCGCGCGGAC No data
Right 934797338 2:97113006-97113028 CAGCCTGGCCGCGGCAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934797338 Original CRISPR CAGCCTGGCCGCGGCAAGTC AGG Intergenic