ID: 934807959

View in Genome Browser
Species Human (GRCh38)
Location 2:97253351-97253373
Sequence GAGCCGTCTGTTCAGGTTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 2, 1: 0, 2: 2, 3: 7, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934807959_934807961 -10 Left 934807959 2:97253351-97253373 CCGATAACCTGAACAGACGGCTC 0: 2
1: 0
2: 2
3: 7
4: 81
Right 934807961 2:97253364-97253386 CAGACGGCTCTAGAAAAGAAAGG 0: 2
1: 0
2: 1
3: 10
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934807959 Original CRISPR GAGCCGTCTGTTCAGGTTAT CGG (reversed) Intronic
904569197 1:31448488-31448510 GGGCTCTCTGTTCTGGTTATTGG + Intergenic
905963842 1:42071463-42071485 GAGGCATCTGTTCAGGTCTTTGG + Intergenic
906296621 1:44652677-44652699 GATCCCTGTGTTCAGGATATTGG - Intronic
912903651 1:113680220-113680242 GAGCCCTCTGCCCAGGTTTTAGG + Intronic
915550781 1:156632545-156632567 GAGGCGTTTGTTCTGGCTATGGG - Intergenic
922069821 1:222180880-222180902 GAGGTGTCTGTTAAGGTTTTTGG - Intergenic
924891901 1:248291749-248291771 GAGGCCTCTGTTCTGTTTATTGG - Intergenic
1063032610 10:2250786-2250808 GAGGTGTCTGTTCAGGTCCTTGG + Intergenic
1079935525 11:26611197-26611219 GAGCTGCATGGTCAGGTTATTGG + Intronic
1092564400 12:9648919-9648941 GAGCCGGCTTTGCAGGTGATGGG + Intergenic
1094038589 12:26098265-26098287 GAAATGTCTGTTCAGGTTCTTGG - Intergenic
1098837244 12:75438220-75438242 GAGCTGTCTGTTAAGGTTTGAGG - Intergenic
1101800770 12:108020113-108020135 GACCCGTCTGATCTGGATATGGG + Intergenic
1102197771 12:111036566-111036588 GAGGGGTTTGTTCAGGTGATGGG + Intronic
1105631360 13:22172326-22172348 GAGCTGTCTATTCAGGTCATGGG + Intergenic
1106637765 13:31547852-31547874 GAGATGTCTGTTCAGATTGTTGG + Intergenic
1112035069 13:95489532-95489554 GAGCTGTCTGTTCATGTCCTTGG + Intronic
1120889668 14:89480472-89480494 GAGCCAGCTGGCCAGGTTATAGG - Intronic
1123960167 15:25389983-25390005 GAGGTGTCTGTTAAGGTTGTTGG - Intronic
1127032684 15:54881170-54881192 GTGCAGTCTGTGCAGGTTATGGG + Intergenic
1129049931 15:72772564-72772586 TAGAGGTTTGTTCAGGTTATAGG - Intronic
1129441201 15:75581977-75581999 GAGCCGTCTGTGCAGGAGAGTGG - Intergenic
1131964200 15:97821618-97821640 GAGAGGTCTGTTCAGGTCTTTGG + Intergenic
1135989939 16:27212149-27212171 GAACAGTCTGTTCAGGTTCCTGG - Intronic
1137551165 16:49438581-49438603 GCGCCGTCTGCTCTGGTTTTGGG + Intergenic
1140772487 16:78217599-78217621 GAGCCCTCTGTTAAGTTTCTCGG - Intronic
1149108867 17:53001800-53001822 TATCAGTCTGTTCAGGTTTTTGG - Intergenic
1150027701 17:61694831-61694853 GAGAAGTCTGTTCAAATTATTGG + Intronic
1157812649 18:50708746-50708768 GAGCCCTCTATTCAGGTCAAAGG + Intronic
1165321333 19:35087065-35087087 GAGGTGTCTGTCCAGGTTAATGG + Intergenic
934625612 2:95847966-95847988 GAGCTTTCTGTTCAGGTTATCGG + Intronic
934807959 2:97253351-97253373 GAGCCGTCTGTTCAGGTTATCGG - Intronic
934829551 2:97503836-97503858 GAGCCGTCTGTTCAGGTTATCGG + Intronic
936729325 2:115361261-115361283 GAGCCGTGTGTTCAAATTCTAGG + Intronic
936973189 2:118194190-118194212 GAGAAGTCTGTTAAGGTTTTTGG - Intergenic
940163865 2:150745997-150746019 GAGGTGTCTGTTAAGGTCATCGG - Intergenic
944940151 2:204616306-204616328 GAGGTGTCTGTTCAGGTCTTTGG - Intronic
945238255 2:207652915-207652937 GAGGCGTCTGTTAAGGTGTTTGG - Intergenic
946071845 2:217040815-217040837 TAGCCGCCTGTGCAGGTTTTTGG + Intergenic
946600388 2:221353751-221353773 GAGGCTTCTGTTCCGGTGATGGG - Intergenic
1169893166 20:10474905-10474927 GAGCCGTGGGTTCAGGCCATGGG + Intronic
1179983145 21:44906864-44906886 GCACCGTCTGTGCTGGTTATTGG - Intronic
1183766300 22:39879141-39879163 GAGGTGTCTGTTAAGGTTTTAGG - Intronic
1184396134 22:44242580-44242602 GAGCTGTCTGTTCTGTTCATTGG + Intergenic
1184757544 22:46525534-46525556 AACCCGTGTGTTCAGGTTACAGG + Intronic
955775496 3:62428233-62428255 GAGCCTTCTTTTCAGGTTTTTGG + Intronic
960019593 3:112933359-112933381 CAGCCTGCTTTTCAGGTTATGGG - Intronic
961558600 3:127713510-127713532 GAGCCATCTGGTCAGGGAATGGG - Intronic
964996639 3:162890865-162890887 GAGATGTCTGTTCAGGATTTTGG - Intergenic
969979671 4:11141716-11141738 AAGCCGGCTGTGCATGTTATAGG + Intergenic
970302265 4:14693565-14693587 GAACCGTCTGTTACTGTTATGGG + Intergenic
976703761 4:88000424-88000446 AAGGTGTCTGTTCAGGTTGTTGG - Intergenic
977530396 4:98193966-98193988 GATACGTCTGAGCAGGTTATAGG + Intergenic
978319329 4:107477096-107477118 GAGCCGGCTGTGCAGGAGATCGG + Intergenic
979918442 4:126469416-126469438 GAACCGACTGTTTATGTTATTGG + Intergenic
980804217 4:137790890-137790912 GAGCATTATGCTCAGGTTATTGG + Intergenic
985769472 5:1799763-1799785 GAGCCGTCTTCTCAGGTCAGGGG - Exonic
987663152 5:20904034-20904056 CTGACGTCTGTTCAGGTTATAGG + Intergenic
988759533 5:34298151-34298173 CTGACGTCTGTTCAGGTTATAGG - Intergenic
989024179 5:37046858-37046880 GAACAGTCTGTCCAGGTTTTTGG + Intronic
992761383 5:79953753-79953775 GAGCTGATTGTTCAGGTTAGGGG - Intergenic
993026827 5:82656738-82656760 GAGTAGTCAGTTCAGGATATTGG + Intergenic
996546923 5:124689581-124689603 GAGCTGACTGTTAAGGTTTTTGG - Intronic
997184540 5:131868481-131868503 GAGGTGTCTGTTCAGGTCTTTGG + Intronic
998360114 5:141578248-141578270 CAGCCGTCCCTTCAGGTCATAGG + Exonic
1000471595 5:161649111-161649133 GAGGCGTCTATTCAGGTGCTCGG + Intronic
1000809969 5:165849133-165849155 GAGCCATCTGTTCAGATCCTTGG - Intergenic
1001940933 5:175738954-175738976 GGGCCGTCTGTGCAGGTGCTTGG - Intergenic
1002591935 5:180296331-180296353 GAGCTGTCTGTTCAGATTCAAGG - Intergenic
1010123466 6:72406525-72406547 TTGTCGTCTGTTCAGGTGATAGG + Intergenic
1011874943 6:91947637-91947659 GAGGTGTATGTTCAGGTTTTTGG - Intergenic
1012828391 6:104176437-104176459 TACCCCTCTGTTCAAGTTATGGG - Intergenic
1022677048 7:32510577-32510599 GAGCCGTCAGGTCTGGTTGTAGG + Intronic
1022677067 7:32510669-32510691 GAGCCGTCAGGTCTGGTTGTGGG + Intronic
1022677118 7:32510945-32510967 GAGCCGTCAGGTCTGGTTGTGGG + Intronic
1022677138 7:32511037-32511059 GAGCCGTCAGGTCTGGTTGTGGG + Intronic
1022677156 7:32511129-32511151 GAGCCGTCAGGTCTGGTTGTAGG + Intronic
1032160086 7:129503021-129503043 CAGCCGTCTTTCCAGGTTTTAGG + Intronic
1036225252 8:6952612-6952634 GAGAAGTCTATTCAGGTCATTGG - Intergenic
1039179536 8:34849983-34850005 GTGCCCTCTGGTCAGTTTATTGG - Intergenic
1039696612 8:39919492-39919514 GAGCAGTCTGCTCAGGATATAGG + Intronic
1046884389 8:119347719-119347741 GAGGTGTCTGTTCAGGTCTTTGG + Intergenic
1047626582 8:126663000-126663022 GAGGTGTCTGTTCAGGTCTTTGG - Intergenic
1048109113 8:131447335-131447357 GAGCAGACTGTTCAGGCTTTTGG + Intergenic
1048331824 8:133475863-133475885 GATCAGTCTCTTCAGGTTCTCGG + Exonic
1051016890 9:12488812-12488834 GAGTTGTCTGTTCAGGTCATTGG - Intergenic
1052141562 9:24991630-24991652 GAGCCTACTGTTCAGGAGATGGG + Intergenic
1055400205 9:75915306-75915328 GAGCAGCCTGTTCTGTTTATGGG + Intronic
1057875832 9:98753949-98753971 GAGCCGACTGTTCAGTTTATAGG - Intronic
1186930753 X:14386904-14386926 GAGGTGTCTGTTCATGTCATTGG + Intergenic
1194593110 X:95825344-95825366 GAGGTGTCTGTTAAGGTTTTTGG - Intergenic
1194942133 X:100023748-100023770 TATCAGTCTGTTCAGGTTTTGGG - Intergenic