ID: 934810512

View in Genome Browser
Species Human (GRCh38)
Location 2:97272844-97272866
Sequence AATCTGAGGCTACTAGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934810511_934810512 -10 Left 934810511 2:97272831-97272853 CCAGGTACTGGAAAATCTGAGGC No data
Right 934810512 2:97272844-97272866 AATCTGAGGCTACTAGAGACTGG No data
934810507_934810512 28 Left 934810507 2:97272793-97272815 CCATCTTTGCTGTTTCACAGGCT No data
Right 934810512 2:97272844-97272866 AATCTGAGGCTACTAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934810512 Original CRISPR AATCTGAGGCTACTAGAGAC TGG Intergenic
No off target data available for this crispr