ID: 934810595

View in Genome Browser
Species Human (GRCh38)
Location 2:97273346-97273368
Sequence ACTTTGAGGCAGAAGAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934810595_934810601 23 Left 934810595 2:97273346-97273368 CCCTTCCTCTTCTGCCTCAAAGT No data
Right 934810601 2:97273392-97273414 GATTGCCCCAGAGCTGCAGTGGG No data
934810595_934810600 22 Left 934810595 2:97273346-97273368 CCCTTCCTCTTCTGCCTCAAAGT No data
Right 934810600 2:97273391-97273413 AGATTGCCCCAGAGCTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934810595 Original CRISPR ACTTTGAGGCAGAAGAGGAA GGG (reversed) Intergenic
No off target data available for this crispr