ID: 934814866

View in Genome Browser
Species Human (GRCh38)
Location 2:97315684-97315706
Sequence TCCCTTTGGTTGGGCACCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934814866_934814871 11 Left 934814866 2:97315684-97315706 CCACTGGTGCCCAACCAAAGGGA No data
Right 934814871 2:97315718-97315740 TCCAACAATGAAGAAGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934814866 Original CRISPR TCCCTTTGGTTGGGCACCAG TGG (reversed) Intergenic