ID: 934815081

View in Genome Browser
Species Human (GRCh38)
Location 2:97317873-97317895
Sequence TTGTAAGTGCATAAAACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934815081_934815085 13 Left 934815081 2:97317873-97317895 CCTTCAGTTTTATGCACTTACAA No data
Right 934815085 2:97317909-97317931 AATTGGAACTTACGTTTAAAAGG 0: 22
1: 345
2: 513
3: 592
4: 663
934815081_934815084 -4 Left 934815081 2:97317873-97317895 CCTTCAGTTTTATGCACTTACAA No data
Right 934815084 2:97317892-97317914 ACAAAGTTATGGTTTGGAATTGG No data
934815081_934815086 14 Left 934815081 2:97317873-97317895 CCTTCAGTTTTATGCACTTACAA No data
Right 934815086 2:97317910-97317932 ATTGGAACTTACGTTTAAAAGGG No data
934815081_934815083 -10 Left 934815081 2:97317873-97317895 CCTTCAGTTTTATGCACTTACAA No data
Right 934815083 2:97317886-97317908 GCACTTACAAAGTTATGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934815081 Original CRISPR TTGTAAGTGCATAAAACTGA AGG (reversed) Intergenic
No off target data available for this crispr