ID: 934815590

View in Genome Browser
Species Human (GRCh38)
Location 2:97323583-97323605
Sequence TTGACTCTTTAGCAGTATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934815585_934815590 4 Left 934815585 2:97323556-97323578 CCTGCACCATCGATGCCACTTTC No data
Right 934815590 2:97323583-97323605 TTGACTCTTTAGCAGTATGTGGG No data
934815586_934815590 -2 Left 934815586 2:97323562-97323584 CCATCGATGCCACTTTCCTCTTT No data
Right 934815590 2:97323583-97323605 TTGACTCTTTAGCAGTATGTGGG No data
934815584_934815590 5 Left 934815584 2:97323555-97323577 CCCTGCACCATCGATGCCACTTT No data
Right 934815590 2:97323583-97323605 TTGACTCTTTAGCAGTATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934815590 Original CRISPR TTGACTCTTTAGCAGTATGT GGG Intergenic
No off target data available for this crispr