ID: 934819493

View in Genome Browser
Species Human (GRCh38)
Location 2:97359921-97359943
Sequence GGGTATTATATTCCTAAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934819493_934819498 17 Left 934819493 2:97359921-97359943 CCTAATTTAGGAATATAATACCC No data
Right 934819498 2:97359961-97359983 GGGACAGAAGAATCAAATGTTGG No data
934819493_934819494 -4 Left 934819493 2:97359921-97359943 CCTAATTTAGGAATATAATACCC No data
Right 934819494 2:97359940-97359962 ACCCAATCATCTCTAGAAATTGG No data
934819493_934819496 -3 Left 934819493 2:97359921-97359943 CCTAATTTAGGAATATAATACCC No data
Right 934819496 2:97359941-97359963 CCCAATCATCTCTAGAAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934819493 Original CRISPR GGGTATTATATTCCTAAATT AGG (reversed) Intergenic
No off target data available for this crispr