ID: 934819496

View in Genome Browser
Species Human (GRCh38)
Location 2:97359941-97359963
Sequence CCCAATCATCTCTAGAAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934819492_934819496 -2 Left 934819492 2:97359920-97359942 CCCTAATTTAGGAATATAATACC No data
Right 934819496 2:97359941-97359963 CCCAATCATCTCTAGAAATTGGG No data
934819493_934819496 -3 Left 934819493 2:97359921-97359943 CCTAATTTAGGAATATAATACCC No data
Right 934819496 2:97359941-97359963 CCCAATCATCTCTAGAAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934819496 Original CRISPR CCCAATCATCTCTAGAAATT GGG Intergenic
No off target data available for this crispr