ID: 934822105

View in Genome Browser
Species Human (GRCh38)
Location 2:97384900-97384922
Sequence TTGACTCTTTAGCAGTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934822105_934822110 4 Left 934822105 2:97384900-97384922 CCCACATACTGCTAAAGAGTCAA No data
Right 934822110 2:97384927-97384949 GAAAGTGGCATCGATGGTGCAGG No data
934822105_934822111 5 Left 934822105 2:97384900-97384922 CCCACATACTGCTAAAGAGTCAA No data
Right 934822111 2:97384928-97384950 AAAGTGGCATCGATGGTGCAGGG No data
934822105_934822109 -2 Left 934822105 2:97384900-97384922 CCCACATACTGCTAAAGAGTCAA No data
Right 934822109 2:97384921-97384943 AAAGAGGAAAGTGGCATCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934822105 Original CRISPR TTGACTCTTTAGCAGTATGT GGG (reversed) Intergenic
No off target data available for this crispr