ID: 934822614

View in Genome Browser
Species Human (GRCh38)
Location 2:97390610-97390632
Sequence TTGTAAGTGCATAAAACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934822609_934822614 14 Left 934822609 2:97390573-97390595 CCCTTTTAAACGTAAGTTCCAAT No data
Right 934822614 2:97390610-97390632 TTGTAAGTGCATAAAACTGAAGG No data
934822611_934822614 -4 Left 934822611 2:97390591-97390613 CCAATTCCAAACCATAACTTTGT No data
Right 934822614 2:97390610-97390632 TTGTAAGTGCATAAAACTGAAGG No data
934822612_934822614 -10 Left 934822612 2:97390597-97390619 CCAAACCATAACTTTGTAAGTGC No data
Right 934822614 2:97390610-97390632 TTGTAAGTGCATAAAACTGAAGG No data
934822610_934822614 13 Left 934822610 2:97390574-97390596 CCTTTTAAACGTAAGTTCCAATT 0: 22
1: 345
2: 513
3: 592
4: 663
Right 934822614 2:97390610-97390632 TTGTAAGTGCATAAAACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934822614 Original CRISPR TTGTAAGTGCATAAAACTGA AGG Intergenic
No off target data available for this crispr